ID: 952952808

View in Genome Browser
Species Human (GRCh38)
Location 3:38538476-38538498
Sequence CTTTGGGAGGCTCTGTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1907
Summary {0: 1, 1: 0, 2: 1, 3: 66, 4: 1839}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952952808 Original CRISPR CTTTGGGAGGCTCTGTGATG GGG Intronic
900032795 1:383267-383289 CTTTGGGAGGCTCAGTCAGGCGG + Intergenic
900044726 1:496344-496366 CTTTGGGAGGCTAAGAGAGGAGG - Intergenic
900053638 1:613157-613179 CTTTGGGAGGCTCAGTCAGGCGG + Intergenic
900066130 1:731250-731272 CTTTGGGAGGCTAAGAGAGGAGG - Intergenic
900066525 1:734658-734680 CTTTGGGAGGCTAAGAGAGGAGG - Intergenic
900066921 1:738065-738087 CTTTGGGAGGCTAAGAGAGGAGG - Intergenic
900230868 1:1556680-1556702 CCTTGTGTGGCTCTGTGTTGAGG - Intronic
900232762 1:1569743-1569765 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
900275347 1:1822556-1822578 CTTTGGGAGGCTGAGGCATGTGG - Intronic
900389088 1:2426412-2426434 CTTTGGGAGGCCATGGGGTGGGG - Intronic
900526977 1:3134204-3134226 CTGTGGGAGCCTCTGTGTAGAGG - Intronic
900668506 1:3833220-3833242 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
900783399 1:4632267-4632289 CCATGTGAGGCTCTGGGATGAGG + Intergenic
900795957 1:4708562-4708584 CCTTGGGCGGCTCTGAGATGAGG - Intronic
901312310 1:8278825-8278847 CTTTGGGAGGCTGAGGGAGGCGG - Intergenic
901349800 1:8584310-8584332 CTTTGGGAGGCTCAGGCAGGAGG + Intronic
901658582 1:10784807-10784829 CTTTGGGAGGCTGAGGCATGTGG - Intronic
901878420 1:12180184-12180206 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
901926017 1:12566632-12566654 CTTTGGGAGGCTGAGGGAGGAGG + Intergenic
901987801 1:13090115-13090137 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
901994011 1:13136652-13136674 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
902035155 1:13452643-13452665 CTTTGGGGGGCTGTGGGAGGTGG - Intergenic
902395671 1:16131334-16131356 CTTTGGGAGGCTGAGGCATGTGG + Intronic
903188876 1:21645369-21645391 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
903210514 1:21815532-21815554 CTTTGGGAGGCCAAGTCATGAGG + Intronic
903231746 1:21926507-21926529 CTTTGGGAGGCTGAGGCATGTGG + Intronic
903368623 1:22820030-22820052 CTTGGGGAGGGTCTGGGGTGGGG - Intronic
903436058 1:23350066-23350088 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
903537210 1:24074839-24074861 CTTTGGGAGGCTGAGTGGGGAGG + Intronic
903608959 1:24596036-24596058 CTTTGGGAGGCTGAGGCATGTGG + Intronic
903616288 1:24660539-24660561 CTTTGGGAGGCTCAGGCAGGAGG + Intronic
903693114 1:25188157-25188179 CTTTGGGAGGCTGTGGCAGGAGG + Intergenic
903696826 1:25213865-25213887 CTTTGGGAGGCTGAGGGAGGCGG + Intergenic
903708698 1:25305994-25306016 GTGTGGGAGGCTGAGTGATGGGG + Intronic
903718412 1:25386424-25386446 GTGTGGGAGGCTGAGTGATGGGG - Intronic
903872342 1:26445467-26445489 CTTTGGGAGGCTCAGGCAGGAGG + Intronic
903878655 1:26493682-26493704 CTTTGGGGGAGTCTGTGATCTGG - Intergenic
903954705 1:27017226-27017248 CTTTGGGAGGCTGTGGCAGGTGG - Intergenic
904063783 1:27732063-27732085 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
904135053 1:28305790-28305812 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
904140460 1:28348960-28348982 CTTTGGGAGGCTAAGTTAGGAGG + Intergenic
904214343 1:28907439-28907461 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
904215702 1:28917032-28917054 CTTTGGGAGGCCCAGGGAGGAGG - Intronic
904665588 1:32118549-32118571 CTTTGGGAGGCTCAGGAAGGAGG + Intronic
904722004 1:32517228-32517250 CTTTGGGAGGCTGAGGTATGTGG + Intronic
905269580 1:36778723-36778745 CCTTGGGAGACTTTGTGATCTGG - Intergenic
905368088 1:37466634-37466656 CTTTGGGAGGCTCAGGCAGGTGG + Intergenic
906174483 1:43758781-43758803 CTTTGGGAGGCTCAGGCAGGAGG + Intronic
906297424 1:44657782-44657804 CTTTGGGAGGCTCAGAAAGGAGG - Intronic
906308317 1:44735437-44735459 CTTTGGGAGGCTGAGTCAGGTGG - Intergenic
906462895 1:46050319-46050341 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
906478778 1:46187049-46187071 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
906653454 1:47531008-47531030 CTTTGGGAGGCCAAGTCATGTGG + Intergenic
906703630 1:47878069-47878091 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
906731089 1:48081688-48081710 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
907006509 1:50920054-50920076 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
907037770 1:51231450-51231472 CTATGGAAAGCACTGTGATGTGG + Intergenic
907038827 1:51239657-51239679 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
907334440 1:53691110-53691132 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
907362197 1:53926966-53926988 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
907404180 1:54243665-54243687 CATTGAGAGGCTCTGAGGTGAGG + Intronic
907507606 1:54932019-54932041 CTTTGGGAGGCTGAGGCATGCGG + Intergenic
907546122 1:55261318-55261340 GTTGGGGAGGCTGTGTGAAGTGG + Intergenic
907747399 1:57226932-57226954 CTTTGGGAGGCTGTGGCAGGAGG + Intronic
907784133 1:57595493-57595515 CTCTGGGAGGCTTAGAGATGTGG + Intronic
908288212 1:62632731-62632753 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
908459565 1:64336311-64336333 CTTTGGGAGGCTGAGGGAGGAGG - Intergenic
908621305 1:65983323-65983345 CTTTTGGAGGTGTTGTGATGGGG + Intronic
908695916 1:66841612-66841634 CTTTGGGAGGCTGAGACATGAGG - Intronic
908874363 1:68653696-68653718 ATTTGTGAGGCTTTGTGATGCGG + Intergenic
908876031 1:68676792-68676814 CTTTGGGAGGCTGAGGCATGAGG - Intergenic
909207820 1:72781924-72781946 CTTTGGGAGGCTCAGGCAGGCGG - Intergenic
909497724 1:76298068-76298090 GTTTGGGAGGCTGAGAGATGAGG + Intronic
910200534 1:84693801-84693823 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
910244870 1:85127869-85127891 CTTTGGGAGGCTGAGTGAGGTGG + Intronic
910350132 1:86287072-86287094 CTTTGGGAGGCTGAGTCAGGAGG - Intergenic
910377870 1:86593248-86593270 CTTTGGGCAGCTCTGTTTTGTGG + Intergenic
910387632 1:86702918-86702940 CTTTGGGAGGCTGTGGCAGGCGG + Intergenic
910871742 1:91840064-91840086 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
910893473 1:92042478-92042500 CTTTGGGAGGCTAAGGCATGAGG + Intronic
910910033 1:92223775-92223797 CTTTGGGAGGCTGAGGCATGTGG - Intronic
910988575 1:93030580-93030602 CTTTGGGAGGCTGAGACATGAGG + Intergenic
911439542 1:97908287-97908309 CTTTGGGAGGCCAAGTGGTGTGG - Intronic
911702164 1:100966338-100966360 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
912741899 1:112205755-112205777 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
913258067 1:116973300-116973322 GTTGGGGAGGCTATGTGTTGTGG - Intronic
913385624 1:118255485-118255507 TTTTGGGAGGCTATGTGTAGTGG - Intergenic
913459660 1:119070632-119070654 CTTTGGGAGGCTGTGACAAGAGG + Intronic
914694518 1:150064610-150064632 CTTTGGGAGGCTAAGTCAGGAGG - Intergenic
914734324 1:150401242-150401264 CTTTGGGAGGCTCAGGTAGGTGG + Intronic
915103828 1:153519938-153519960 CTTTGGGAGGCTCAGGGGGGCGG + Intergenic
915256767 1:154637895-154637917 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
915573163 1:156757034-156757056 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
915600217 1:156918123-156918145 CTTTGGGAGGCTGAGTGGGGAGG + Intergenic
915743753 1:158140434-158140456 AATTGGGAAGCGCTGTGATGAGG + Intergenic
915782947 1:158573880-158573902 CTTTGGGAGGCTCAGGGAGGCGG - Intergenic
915831186 1:159132102-159132124 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
916072850 1:161181412-161181434 CTTTGGGAGGCCCAGTTAGGTGG + Intergenic
916139366 1:161680510-161680532 CTTTGGGAGGCTAAGTGGGGAGG - Intergenic
916200282 1:162264748-162264770 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
916362677 1:163988756-163988778 CTTTGGGAGGCTGAGGCATGAGG - Intergenic
916734406 1:167594585-167594607 CTTTGGGAGGCTGAGTCAGGCGG - Intergenic
916751864 1:167730520-167730542 CTTTGGGAGGCTGTGGCAGGCGG - Intronic
916969587 1:169997625-169997647 CTTTGGGAGGCTGAGGCATGTGG + Intronic
917086692 1:171311167-171311189 TTTTTGGAGGCTCTGAGAAGTGG - Intergenic
917312667 1:173693039-173693061 CTTTGGGAGGCCAAGGGATGGGG + Intergenic
917330946 1:173879706-173879728 CTTTGGGAGGCCCAGGTATGTGG + Intronic
917742178 1:177971321-177971343 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
917791376 1:178501318-178501340 CTGTGGGAGGCGCTGTGAACTGG + Intergenic
918052779 1:180989246-180989268 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
918105454 1:181412326-181412348 CTTTGGGAGGCTGAGTGAGGAGG + Intergenic
918473733 1:184901724-184901746 CCTGGGGAGGCTTGGTGATGTGG - Intronic
918570554 1:185986747-185986769 CTTTGGGAGGCTGTGGCAGGAGG + Intronic
918615357 1:186538019-186538041 CTTTGGGAGGCTGAGACATGTGG + Intergenic
919224051 1:194671146-194671168 CTTTGGGAGGCTAAGTCAGGAGG + Intergenic
919453845 1:197800801-197800823 CCCTGGGAGCCACTGTGATGAGG + Intergenic
919575453 1:199303264-199303286 CTTTGGGAGGCTGAGTCAGGAGG - Intergenic
919687140 1:200494520-200494542 CTTTGGGAGGCTCAGGCAAGAGG - Intergenic
919864299 1:201768079-201768101 CTTTGGGAGGCTGAGGGAGGCGG + Intronic
919885180 1:201928469-201928491 CTTTGGGAGGCCCAGTGCTTGGG - Intronic
920151611 1:203913886-203913908 CTTTGGGAGGCCTTGGCATGGGG - Intergenic
920165678 1:204034010-204034032 CTTTGGGAGGCTCAGGCAGGTGG + Intergenic
920193732 1:204212389-204212411 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
920719188 1:208371077-208371099 CTTCCGGGGGCTCGGTGATGAGG - Intergenic
921074253 1:211687014-211687036 CTTTGGGAGGCCCAGGCATGTGG - Intergenic
921268632 1:213447325-213447347 CTTTGGGAGGCTGGGGTATGAGG - Intergenic
921506097 1:215972170-215972192 CAGTGGGAGGCACTGTGAGGAGG + Intronic
921594543 1:217039855-217039877 ATTTGGGAAGCACTGGGATGGGG - Intronic
921867477 1:220101450-220101472 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
921894580 1:220386448-220386470 CTTTGGGAGGCTGAGGGAGGCGG - Intergenic
922096951 1:222450685-222450707 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
922101248 1:222478599-222478621 CTTTGGGAGGCTAAGAGAGGAGG - Intergenic
922262335 1:223953715-223953737 CTTTGGGAGGCTAAGAGAGGAGG - Intergenic
922305539 1:224340998-224341020 CTCTGGGGGTCTCTGCGATGGGG - Intergenic
922366048 1:224864747-224864769 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
922515097 1:226201774-226201796 CTTTGGGAGGCTGAGTGGGGAGG - Intergenic
922733369 1:227966060-227966082 CTTTGGGAGGCTAAGAGAGGAGG + Intergenic
923033730 1:230269427-230269449 CTTTGGGAGGCTGAGGCATGTGG - Intronic
923169090 1:231396493-231396515 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
923720694 1:236464354-236464376 CTTTGGGAGGCTGTGGCAAGAGG - Intronic
923736498 1:236613869-236613891 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
923772720 1:236951475-236951497 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
924056856 1:240132650-240132672 GTTTGTCAGGGTCTGTGATGAGG + Intronic
924216711 1:241830024-241830046 CTTTGGGAGGCTGAGTCAAGGGG + Intergenic
924336364 1:242990304-242990326 CTTTGGGAGGCTCAGTCAGGCGG + Intergenic
924344172 1:243058716-243058738 CTTTGGGAGGCTAAGAGAGGAGG - Intergenic
924650741 1:245924905-245924927 CTTTGGGAGGCTAAGGGAGGTGG - Intronic
924669849 1:246112936-246112958 CTTTGGGAGGCTGTGGCAGGCGG + Intronic
924713310 1:246549336-246549358 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
924736579 1:246762596-246762618 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
924745809 1:246832596-246832618 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
924829163 1:247574200-247574222 CTCAGGGAGGATCTCTGATGGGG - Exonic
924911706 1:248520627-248520649 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
924912168 1:248525770-248525792 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
1063049381 10:2430224-2430246 CTGTGGGAGGCTGTGTGATTGGG - Intergenic
1063050647 10:2443572-2443594 CTTTGGGAGGCTGAGGGGTGTGG - Intergenic
1063213940 10:3906994-3907016 CTTTTGGAGCCACTGTGACGCGG + Intergenic
1063425044 10:5944137-5944159 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
1063556065 10:7081033-7081055 GTTTGGGAAGCTCCGTGGTGGGG - Intergenic
1063627890 10:7707806-7707828 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
1064011300 10:11738640-11738662 ACTTGGGAGGCTGTGTGAGGAGG - Intergenic
1064211889 10:13366729-13366751 CTTTGGGAGGCTCAGGCAGGTGG - Intergenic
1064355538 10:14614427-14614449 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
1064438572 10:15332948-15332970 CTCTGGTGGGCTCTGTGTTGAGG - Intronic
1064490027 10:15845748-15845770 CTTTGGGAGGCTGAGGGAAGAGG - Intronic
1064643952 10:17441550-17441572 CTTTGGGAGGCTGTGGCAGGTGG - Intronic
1064728391 10:18304197-18304219 CTTTGGGAGGCTGAGTCAGGAGG - Intronic
1064858511 10:19798202-19798224 CTTTGGGAGGCTGAGGGAAGAGG + Intergenic
1065033905 10:21618263-21618285 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
1065097885 10:22299907-22299929 CTTTGGGAGGCTGAGTGGGGAGG - Intergenic
1065360167 10:24881961-24881983 CTTTGGGAGGCTGAGTCAGGCGG + Intronic
1065364169 10:24918656-24918678 CTTTGGGAGGCTGAGTGGGGAGG - Intronic
1065371408 10:24990848-24990870 CTTTGGGAGGCTGAGGGGTGGGG + Intronic
1065517277 10:26536852-26536874 CTTTGGAAGGCTGAGTGAGGCGG - Intronic
1065550602 10:26865139-26865161 CTTTGGGAGGCCCAGGCATGTGG + Intergenic
1065577711 10:27140246-27140268 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
1065699795 10:28413903-28413925 CTTTGGGAGGCTCAGGCAGGTGG + Intergenic
1065728472 10:28689522-28689544 CTTTGGGAGGCTCTGGAGGGAGG - Intergenic
1066392931 10:34993343-34993365 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1066589572 10:36979795-36979817 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1066618509 10:37320699-37320721 CTTTGGGAGGCTGTGGCAGGTGG - Intronic
1066720174 10:38329402-38329424 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1066732164 10:38446351-38446373 CTTTGGGAGGCTAAGAGAGGAGG + Intergenic
1066793643 10:39094392-39094414 CTTTTGGAGAATCTGTGAAGGGG + Intergenic
1067029240 10:42869224-42869246 CTTTGGGAGGCTGTGGCAGGGGG - Intergenic
1067238969 10:44474515-44474537 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1067592040 10:47522028-47522050 CTTTGGGAGGCTGTGGCAGGCGG - Intronic
1067639157 10:48030099-48030121 CTTTGGGAGGCTGTGGCAGGCGG - Intergenic
1067759409 10:49032319-49032341 CTTTGGGGAGCCCAGTGATGTGG - Intronic
1067795761 10:49320436-49320458 CTTAGGGTGGTTCTGGGATGAGG + Intronic
1067880966 10:50044616-50044638 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1068043479 10:51856720-51856742 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
1068094136 10:52469228-52469250 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
1068643931 10:59444358-59444380 CTTTGGGAGGCTGAGTTCTGAGG - Intergenic
1068773650 10:60849257-60849279 ATTTGGGAAGCCCTGTGGTGTGG + Intergenic
1069115072 10:64494693-64494715 CTTTGGGAGGCTGAGTCAGGTGG - Intergenic
1069418515 10:68224341-68224363 CTTTGGGAGGCTCAGACAGGAGG - Intergenic
1069446596 10:68478620-68478642 CTTTGGGAGGCTGAGCGAGGAGG - Exonic
1069455271 10:68548969-68548991 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1069500305 10:68946945-68946967 CTTTGGGAGGCTGTGTTGGGCGG + Intergenic
1069524421 10:69155039-69155061 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
1069543167 10:69310811-69310833 CTTTGGGAGGCTGTGGCAGGCGG + Intronic
1069679878 10:70276828-70276850 CTTTGGGAGGCTGAGTCAGGCGG - Intronic
1069749813 10:70738001-70738023 CTTTTGGAGGCACTATAATGAGG - Intronic
1069998661 10:72359643-72359665 CTTAGGGAGGCCCTGTGTGGCGG - Intergenic
1070017422 10:72547280-72547302 CTTTGGGAGGCTATGGCAGGAGG - Intronic
1070068672 10:73064221-73064243 CTTTGGGAGGCTGCGGGGTGCGG + Intronic
1070096601 10:73343463-73343485 CTTTGGGAGGCTGAGACATGCGG + Intronic
1070394636 10:76001367-76001389 CTTTGATACGCTGTGTGATGGGG - Intronic
1070611133 10:77933535-77933557 CTTTGGGAGGCTGAGTGGGGTGG - Intergenic
1070793262 10:79202358-79202380 CTTTGGGAGGCTAAGGGAGGAGG + Intronic
1070796211 10:79218228-79218250 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
1071440520 10:85688455-85688477 CTTTGGGAGGCTGGGGCATGTGG - Intronic
1071503183 10:86217880-86217902 CTGAGGCAGGCTCTGTGGTGTGG - Intronic
1071687242 10:87772354-87772376 CTTTGGGAGGCTGAGTGGGGAGG - Intronic
1071707270 10:88012610-88012632 CTTTGGGAGGCTGGGTCAGGAGG - Intergenic
1071732944 10:88267331-88267353 CTTTGGGAGGCTCAGTCAGGAGG + Intergenic
1072109108 10:92301128-92301150 CTTTGGGAGGCTGAGTGGGGAGG - Intronic
1072344738 10:94493012-94493034 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1072421342 10:95292172-95292194 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1072447052 10:95508179-95508201 CTTTGGGAGGCTGAGGTATGAGG - Intronic
1072537229 10:96372931-96372953 CTTTGGGAGGCTGAGTGGGGAGG - Intronic
1072633177 10:97160966-97160988 CTTTGGGAGGCCAGGTGGTGGGG - Intronic
1072640625 10:97208504-97208526 CTTTGGGAGGCTAAGTCAGGAGG + Intronic
1073001293 10:100287939-100287961 CTTTGGGAGGCTATGTTGGGTGG - Intergenic
1073092436 10:100953387-100953409 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1073140691 10:101245541-101245563 CTTTGGGAGGCTGAGGGAGGAGG - Intergenic
1073273831 10:102290746-102290768 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
1073309618 10:102530992-102531014 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1073364509 10:102927514-102927536 CTTTGGGAGGCCCAGGGAGGTGG + Intronic
1073793189 10:106960642-106960664 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
1074474338 10:113755646-113755668 CTTTGGGAGGCTGAGAGGTGGGG - Intronic
1074502510 10:114039594-114039616 CTTTGGGAGGCTGAGTCAGGAGG - Intergenic
1074851589 10:117443595-117443617 CTTTGTGGGGCACTGTGTTGAGG + Intergenic
1075111580 10:119590466-119590488 CTTTGGGAGGCTATGGCAGGCGG + Intronic
1075344582 10:121672919-121672941 CCATGGGAGGCGCTGTGGTGGGG + Intergenic
1075598232 10:123747767-123747789 CTTTGGGAGGCTGGGTGTGGTGG + Intronic
1075744267 10:124715613-124715635 CGTGGGCAGGCTCTGTGCTGAGG - Intronic
1075837391 10:125466464-125466486 CTTTGGGAGGCTGAGGCATGGGG - Intergenic
1076010157 10:126981189-126981211 CTTTGGGAGGCTCAGGTGTGTGG - Intronic
1076052044 10:127342999-127343021 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
1076390786 10:130100077-130100099 CTTTGGGAGGCTGTGTTGGGTGG - Intergenic
1076882555 10:133246660-133246682 CTTTGGGAGGCCGAGTGAGGTGG + Intergenic
1076935977 10:133567754-133567776 CTTTGGGCGGCTCTGGAGTGTGG + Intronic
1076971051 11:132819-132841 CTTTGGGAGGCTAAGAGAGGAGG - Intergenic
1077003981 11:342190-342212 CTTTGGGAGGCTGAGGGAGGAGG - Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077226400 11:1440713-1440735 CTGTGGGAGGCCCTGGGATGAGG + Intronic
1077544630 11:3164125-3164147 CTTTGGGAGGCTGTATCAGGTGG + Intronic
1077640736 11:3879197-3879219 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1077644973 11:3915638-3915660 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1078071608 11:8115562-8115584 CTTTGGGAGGCTGTGACAGGTGG + Intronic
1078220347 11:9346537-9346559 CTTTGGGAGGCCCAGTCAGGCGG + Intergenic
1078256805 11:9664828-9664850 CTTTGGGAGGCTTTTTGACTTGG + Intronic
1079091407 11:17482839-17482861 CTTTGGAAGGGGGTGTGATGTGG + Intergenic
1079193798 11:18305973-18305995 CTTTGGGAGGCTGTGGCAGGCGG - Intronic
1079196381 11:18331297-18331319 CTTTGGGAGGCTGTGGCAGGTGG - Intronic
1079384264 11:19965060-19965082 CTTTGGGAGGCTGAGTGGGGTGG - Intronic
1079587363 11:22142374-22142396 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1080232865 11:30037394-30037416 CCTTGTGAGGCTCTGTCAGGAGG - Intergenic
1080326936 11:31085974-31085996 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1080496057 11:32820397-32820419 CTTTGGGAGGCTGAGGCATGAGG - Intergenic
1080541006 11:33265528-33265550 CTTTGGGAGGCTGTGGTGTGTGG + Intronic
1080563567 11:33487090-33487112 CTTTAGGAGGCCCGCTGATGGGG + Intergenic
1080899985 11:36480605-36480627 CTTTGGGAGGCCCAGGCATGAGG - Intergenic
1081041295 11:38217485-38217507 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1081560619 11:44212040-44212062 CTTTGGGAGGCTGAGTCAAGCGG + Intronic
1081595468 11:44455955-44455977 CTTTGGGAGGCTGAGGGAGGCGG - Intergenic
1081768882 11:45634721-45634743 CTTTGGGAGGCCAAGTGATTTGG + Intergenic
1083057348 11:59835375-59835397 CTTTGGGAGGCTGAGGCATGCGG - Intronic
1083253731 11:61483990-61484012 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
1083358827 11:62090737-62090759 CTTTGGGAGGCTGAGTGAGGCGG - Intergenic
1083374388 11:62207839-62207861 CTTTGGGAGGCTGAGTGAGGTGG + Intergenic
1083451181 11:62746461-62746483 CTTTGGGAGGCTCAGTCTGGTGG - Intergenic
1083473285 11:62898758-62898780 CTTTGGGAGGCTCAGGCAGGTGG - Intergenic
1083647738 11:64182541-64182563 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1083822288 11:65180130-65180152 CTTTGGGAGGCTCAGGCAGGAGG + Intronic
1083917596 11:65758989-65759011 CTTTGGGAGGCTGAGTCAGGCGG - Intergenic
1083985709 11:66213788-66213810 CTTTGGGAGGCTGTGGCAGGCGG + Intronic
1084342345 11:68514308-68514330 CTTTGGGAGGCTCTGACGGGTGG - Intronic
1084389052 11:68862918-68862940 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1084407674 11:68985870-68985892 CTTTGGGAGGCTGTGGTAGGTGG - Intergenic
1084555999 11:69876184-69876206 GCTTGGGAGGCTCTGGGATCTGG - Intergenic
1084718717 11:70890395-70890417 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1084908120 11:72364601-72364623 CTTTGGGAGGCTGTGGCAGGAGG - Intronic
1085030521 11:73268378-73268400 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
1085098088 11:73777081-73777103 CTTTGGGAGGCCCAGGGAGGAGG + Intergenic
1085124494 11:73990122-73990144 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1085358616 11:75864297-75864319 CTTTGGGAGGCTGAGTTAGGCGG - Intronic
1085373829 11:76039629-76039651 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
1085436439 11:76508112-76508134 CTTTGGGAGGCTGTGGCAGGTGG - Intronic
1085491580 11:76924058-76924080 CCTTGGCAGGCTCCCTGATGAGG - Intronic
1085667716 11:78430212-78430234 CTTTGGGAGGCTGAGGGAAGCGG + Intergenic
1085897786 11:80660755-80660777 CTTTGGGAGGCTGAGTGGGGTGG + Intergenic
1086152772 11:83630682-83630704 CTTAGGGAGGCAGAGTGATGTGG + Intronic
1086333696 11:85778731-85778753 CTTTGGGAGGCTGAGTCAGGCGG + Intronic
1086346547 11:85902986-85903008 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1086370265 11:86149304-86149326 CTTTGGGAGGCTCAGGCAGGAGG - Intergenic
1086656135 11:89358139-89358161 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1086862158 11:91937465-91937487 TTTTGGGAGGCTGTGTTAGGGGG - Intergenic
1087096301 11:94322304-94322326 CTTTGGGAGGCTGAGTGAGGTGG + Intergenic
1087542082 11:99532977-99532999 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1087728034 11:101744884-101744906 CTTTGGGAGGCTCAGGCAGGAGG - Intronic
1087838099 11:102894903-102894925 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1087899451 11:103624519-103624541 CTTTGGGAGGCTCAGGCAGGTGG + Intergenic
1088093584 11:106073343-106073365 CTTTGGGAGGCTGAGGCATGAGG - Intronic
1088252554 11:107873725-107873747 CTTTGGGAGGCTACGGCATGTGG - Intronic
1088363190 11:109012409-109012431 CTTTGGGCTGCCCTGTGTTGGGG - Intergenic
1088459459 11:110067260-110067282 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
1088615982 11:111628668-111628690 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1088663561 11:112072618-112072640 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
1088746767 11:112810320-112810342 CTTTGGGAGGCTAAGTTAGGTGG - Intergenic
1089069844 11:115690888-115690910 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1089261224 11:117225303-117225325 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1089291596 11:117440666-117440688 CTTTGGGAGGCTGTGGCAGGCGG + Intronic
1089431499 11:118428642-118428664 CTTTGGGAGGCTGAGTCAGGCGG - Intronic
1090389310 11:126377717-126377739 CTTTGGGAGGCTGAGAGAGGTGG - Intronic
1090656301 11:128848433-128848455 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1090813498 11:130268821-130268843 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
1091197231 11:133742082-133742104 CTTTGGGAGGCTGAGACATGAGG + Intergenic
1091287322 11:134414858-134414880 CTTTGGGGGCCTCTGAGAAGAGG - Intergenic
1091581664 12:1794024-1794046 CTCTGGGAGCATCTCTGATGGGG + Intronic
1092008406 12:5088502-5088524 CTGTGGCTGGATCTGTGATGTGG + Intergenic
1092223859 12:6733688-6733710 CTTTGGGAGGCTCAGGCAAGCGG - Intergenic
1092235273 12:6803539-6803561 CTTTGGGAGGCTGTGGCAGGCGG + Intronic
1092382198 12:8006060-8006082 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1092454144 12:8627156-8627178 CTTTGGGAGGCCCAGTCAGGCGG - Intergenic
1092476847 12:8826860-8826882 CTTTGGGAGGCTGAGTGGGGAGG - Intronic
1092787519 12:12041191-12041213 CTTTGGGAGGCTGAGGTATGCGG + Intergenic
1093448670 12:19290172-19290194 CTTTGGGAGGCTGAGGGAGGCGG - Intronic
1093655172 12:21686684-21686706 CTTTGGGAGGCTGAGTGGGGTGG + Intronic
1093807934 12:23457645-23457667 CTTTGGGAGGCTGAGGGAGGCGG - Intergenic
1093874026 12:24327933-24327955 CTTTGGGAGGCTGTGGCAGGTGG - Intergenic
1093887258 12:24476364-24476386 CTTTGCAAAGATCTGTGATGAGG - Intergenic
1093935868 12:25000200-25000222 CTTTGGGAGGCTGTGTTGGGTGG + Intergenic
1094014895 12:25851911-25851933 CTTTGGGAGGCTGAGGCATGAGG - Intergenic
1094051781 12:26228150-26228172 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1094155931 12:27336705-27336727 CTTTGGGAGGCTATGGCAGGTGG + Intronic
1094247589 12:28318276-28318298 CTTTGGGAGGCTGTGGCAGGAGG + Intronic
1094540712 12:31361357-31361379 CTTTGGGAGGCTGAGGGAGGAGG - Intergenic
1094547017 12:31414170-31414192 CTTTGGGAGGCTGAGGGAAGAGG - Intronic
1094592854 12:31837679-31837701 CTTTGGGAGGCTGAGGGGTGGGG - Intergenic
1094626939 12:32133242-32133264 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
1094665802 12:32519545-32519567 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1095269372 12:40198759-40198781 CTTTGGGAGGCTGAGTCAGGAGG - Intronic
1095457196 12:42400616-42400638 CTTTGGGAGGCTCAGAGAGGAGG - Intronic
1095457863 12:42408260-42408282 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
1095637061 12:44447204-44447226 CTTTGGGAGGCTGAGGCATGAGG + Intergenic
1095649070 12:44585356-44585378 CTTTGGGAGGCTGAGGGAGGCGG + Intronic
1095674531 12:44900745-44900767 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
1095723104 12:45422815-45422837 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1095888265 12:47211406-47211428 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1095956887 12:47812098-47812120 CTTGGGGAGGGTCTGGGATGGGG - Intronic
1096131656 12:49164108-49164130 CTTTGGGAGGCTGTGGCAGGGGG - Intergenic
1096164014 12:49405452-49405474 CTTTGGGAGGCTCAGTTGGGTGG + Intronic
1096170627 12:49466409-49466431 CTTTGGGAGGCTGAGGCATGAGG - Intronic
1096261306 12:50093723-50093745 CTTTGGGAGGCTCAGGTAAGAGG - Intronic
1096266496 12:50127108-50127130 CTTTGGGAGGCTGAGGGAGGAGG - Intergenic
1096267032 12:50131851-50131873 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
1096410539 12:51374101-51374123 CTTTGGGAGGCTGTGGCAGGAGG - Intronic
1096464371 12:51840198-51840220 CTTGGGGTGGCCCTGTGATCTGG + Intergenic
1097024285 12:56042670-56042692 CTTTTGGAGGCTCTGTTCTTTGG + Intronic
1097131626 12:56815370-56815392 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1097228842 12:57496404-57496426 CTTTGGGAGGCTCAGGCAGGCGG - Intronic
1097333373 12:58356080-58356102 CTTTGGGAGGCTGAGAGAGGAGG - Intergenic
1097523366 12:60697868-60697890 CTTTGGGAGGCTGAGGGCTGTGG + Intergenic
1097697841 12:62791675-62791697 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
1097857085 12:64474872-64474894 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
1097886261 12:64732409-64732431 CTTTGGGAGGCTGAGTCAGGCGG - Intronic
1098043234 12:66373330-66373352 CTTTGGGAGGCTAAGTGGGGTGG - Intronic
1098251667 12:68576571-68576593 CTTTGGGAGGCCAAGTGAGGAGG + Intergenic
1098308105 12:69121483-69121505 CTTTGGGAGGCTGAGTGGGGTGG - Intergenic
1098311315 12:69151911-69151933 CTTTGGGAGGCCAAGTGAGGAGG + Intergenic
1098312824 12:69164663-69164685 CTTTGGGAGGCTGAGGGAGGAGG - Intergenic
1098335508 12:69400602-69400624 CTTTGGGAGGCTAAGGCATGAGG + Intergenic
1099193181 12:79582025-79582047 CTTTGGGAGGCTCAGTTGGGTGG + Intronic
1099788019 12:87292387-87292409 CTTTGGTAGGCTCAGGCATGTGG - Intergenic
1100171440 12:91979168-91979190 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1100357549 12:93845478-93845500 CTTTGGGAGGCTGGGTCACGAGG + Intronic
1100609569 12:96180034-96180056 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1100623678 12:96307050-96307072 CTTTGGGAGGCTGTGGCAGGAGG + Intronic
1100638494 12:96458783-96458805 CTTTGGGAGGCTCAGTTGGGCGG - Intergenic
1100840404 12:98607155-98607177 CTTTGGGAGGCCCTGGCAGGTGG + Intergenic
1100875532 12:98957587-98957609 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
1100981797 12:100167844-100167866 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1101015404 12:100495487-100495509 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
1101169309 12:102072647-102072669 CTTTAAGAATCTCTGTGATGGGG - Intergenic
1101477686 12:105066055-105066077 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1101515456 12:105430697-105430719 CTTTGGGAGGCTGAGGGGTGTGG + Intergenic
1102123032 12:110457882-110457904 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1102145323 12:110650941-110650963 CTTTGGGAGGCTGAGTCAGGAGG - Intronic
1102200504 12:111054868-111054890 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
1102235279 12:111290668-111290690 CTTTGGGAGGCTGTGGCAGGTGG - Intronic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1102890414 12:116554325-116554347 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1103100389 12:118169552-118169574 CTTTGGGAGGCTCAGGCAGGCGG - Intronic
1103105315 12:118219357-118219379 CTTTGGGAGGCTAAGGGAGGAGG - Intronic
1103154846 12:118675636-118675658 CTTTGGGAGGCTGAGTGGAGTGG + Intergenic
1103230051 12:119322018-119322040 CTTTGGGAGGCTGTGGCAGGTGG + Intergenic
1103265229 12:119624104-119624126 CTTTGGGAGGCTCTGGCAGGTGG + Intronic
1103369216 12:120405640-120405662 CTTTGGGAGGCTGAGGGAGGAGG + Intergenic
1103458764 12:121087513-121087535 CTTTGGGAGGCTCTGTCCTATGG - Intergenic
1103495171 12:121356327-121356349 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
1103551337 12:121739713-121739735 CTTTGGGAGGCTGTGGTGTGTGG - Intronic
1103584153 12:121938571-121938593 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
1103597658 12:122033698-122033720 CTTTGGGAGGCTCAGGCAGGAGG - Intronic
1103603599 12:122070424-122070446 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1104015552 12:124959464-124959486 CTTTGGGAGGCTGAGACATGTGG - Intronic
1104858188 12:131911645-131911667 CTCTGGGAGGCCCTGTTTTGGGG - Intronic
1105219031 13:18308518-18308540 CTTTGGGAGGCTGAGGGAGGCGG + Intergenic
1105366518 13:19770414-19770436 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
1105386280 13:19932402-19932424 CTTTGGGAGGCTGTGGCAGGTGG + Intergenic
1105618088 13:22039708-22039730 CTTTGGGAGGCTAAGGGGTGTGG - Intergenic
1105839973 13:24245830-24245852 CTTTGGGAGGCTCAGGCAGGAGG - Intronic
1105909040 13:24843273-24843295 CTTTGGGAGGCTCAGGCAGGCGG + Intronic
1105971561 13:25433515-25433537 CTTTGGGAGGCTCAGGCAGGAGG - Intronic
1106007300 13:25782982-25783004 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1106018447 13:25891680-25891702 CATTAGGGGGCTCTGTGAGGTGG + Intronic
1106096488 13:26649835-26649857 CTTTGGGAGGCTGAATCATGAGG + Intronic
1106157953 13:27174557-27174579 CATTGTGAGGCTCTGTGATTAGG - Intergenic
1106218730 13:27726529-27726551 CTTTGGGAGGCTGTGGCAGGCGG + Intergenic
1106331314 13:28742122-28742144 CTTTGGGAGGCTAAGTCAGGCGG - Intergenic
1106390742 13:29333438-29333460 CTTTGGGAGGCTAAGGCATGCGG - Intronic
1106754538 13:32809575-32809597 CTTTGGGAGGCTGTGGCAGGAGG + Intergenic
1107123188 13:36817699-36817721 CTTTGGGAGGCTCAGGCAGGTGG - Intergenic
1107284739 13:38778476-38778498 CTTTGGGAGGTACTTTGGTGAGG - Intronic
1107509751 13:41071797-41071819 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1108385957 13:49899511-49899533 CTTTGGGAGGCCAAGTGGTGTGG - Intergenic
1108387451 13:49913176-49913198 CTTTGGGAGGCTGAGGGAGGTGG + Exonic
1108503166 13:51086061-51086083 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1108549925 13:51533734-51533756 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1109217366 13:59604860-59604882 CTTTGGGAGGCTGAGTGGGGTGG + Intergenic
1109450020 13:62500605-62500627 CTTTGGGAGGCTCAGGCAGGAGG + Intergenic
1109463337 13:62692827-62692849 CTTTGGGAGGCTGTGGCAGGCGG + Intergenic
1109557457 13:63998287-63998309 CTTTGGGAGGCTGAGGGAGGAGG - Intergenic
1109626684 13:64983234-64983256 CTGTGAGAGACTCTGTGGTGAGG - Intergenic
1110785412 13:79519048-79519070 CTTTGGGAGGCTGAGGGAAGCGG - Intronic
1110977827 13:81862863-81862885 CTTTGGGAGGCTGAGTTAAGTGG + Intergenic
1111157115 13:84342208-84342230 CTTTGGGAGGCTGTGGCAGGCGG + Intergenic
1111298708 13:86318193-86318215 CTTTGGGAGGCCCAGTGGGGTGG + Intergenic
1111355685 13:87099009-87099031 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1111920954 13:94410753-94410775 CTTTGGGAGGCCCGGGGGTGGGG + Intergenic
1112042629 13:95562314-95562336 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1112054915 13:95681595-95681617 CTTTGGGAGGCCAAGGGATGAGG - Intronic
1112190993 13:97177092-97177114 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
1112251382 13:97783778-97783800 CTTTTGGGGGCTCTCTGTTGTGG - Intergenic
1112296573 13:98192632-98192654 CTTTGGGAGGCTGTGGCAGGTGG - Intronic
1112313736 13:98342779-98342801 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
1112314176 13:98346499-98346521 CTTTGGGAGGCTCAGGCAGGAGG + Intronic
1112541801 13:100320987-100321009 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1112634721 13:101202673-101202695 CCTTTGGAGGCTGTGTGAGGAGG - Intronic
1112728632 13:102334100-102334122 CTTTGGGTGGCTCATTAATGGGG - Intronic
1113154713 13:107306718-107306740 CTTTGGGAGGCTGAGGGAAGTGG + Intronic
1113213311 13:108007998-108008020 CTTTGGGAGGCTGAGTCAGGTGG - Intergenic
1113333284 13:109352799-109352821 CTTTGGGAGGCTGAGGGAGGAGG + Intergenic
1113592957 13:111513521-111513543 CTTTGGGAGGCTGAGTCAGGAGG - Intergenic
1113804413 13:113104946-113104968 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1114296011 14:21329872-21329894 CTTTGGGAGGCTGAGGCATGCGG + Intronic
1114515749 14:23299207-23299229 CTTTGGGAGGCTGAGTTAGGTGG - Intronic
1114543291 14:23479795-23479817 CTTTGGGAGGCTGGGTCAGGAGG + Intronic
1114586187 14:23816156-23816178 CTTTGGGAGGCTGAGGGAAGAGG - Intergenic
1114952261 14:27770122-27770144 CTTTGGGAGGCTGAGACATGCGG + Intergenic
1115196797 14:30809504-30809526 CTTTGGGAGGCTGAGTGGGGAGG + Intergenic
1115222494 14:31071659-31071681 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
1115234556 14:31196258-31196280 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
1115471154 14:33770006-33770028 CTTTGGGAGCCTCAGGGAGGAGG - Intronic
1115539651 14:34408427-34408449 CTTTGGGAGGCTGAGGCATGAGG + Intronic
1115774467 14:36700130-36700152 CTTTGGGAGGCTGTGGTAGGAGG - Intronic
1115952523 14:38737247-38737269 CTTTGGGAGGCTCTGCCCTCAGG + Intergenic
1116295101 14:43097682-43097704 CTTTGGGAGGCTGAGACATGTGG - Intergenic
1116325997 14:43534367-43534389 CTTTGGGAGGCTGAGGGAGGCGG + Intergenic
1116470052 14:45276107-45276129 CTTTGGGAGGCTGAGGCATGCGG - Intergenic
1116471469 14:45290633-45290655 CTTTGGGAGGCTGAGGCATGAGG + Intergenic
1116471692 14:45293001-45293023 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1116806310 14:49496960-49496982 CTTTGGGAGGCTGTGGTAGGTGG - Intergenic
1116807580 14:49508853-49508875 CTTTGGGAGGCTGACTGAGGCGG + Intergenic
1116881685 14:50176764-50176786 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1117066120 14:52014530-52014552 TTTTTGGAGGCTCTGGTATGTGG - Intronic
1117130092 14:52677619-52677641 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
1117559360 14:56920779-56920801 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1117706845 14:58478573-58478595 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1117881208 14:60315397-60315419 GCCTGGGAGGCTCTGGGATGGGG - Intergenic
1117904967 14:60575399-60575421 CTTTGGGAGGCTGAGTAGTGTGG + Intergenic
1118395587 14:65333786-65333808 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1118644521 14:67824499-67824521 CTTTGGGAGGCTGAGGGAGGCGG - Intronic
1118990875 14:70795996-70796018 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1119020055 14:71102507-71102529 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
1119214475 14:72858059-72858081 CTTTGGGAGGCTCAGGCAGGCGG + Intronic
1119236096 14:73020593-73020615 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
1119346634 14:73930404-73930426 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1119358317 14:74025882-74025904 CTTTGGGAGGCTGAGTGGCGGGG + Intronic
1119382311 14:74237147-74237169 CTTTGGGAGGCTGAGGGAGGCGG - Intergenic
1119507398 14:75184886-75184908 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1119590346 14:75881155-75881177 CTTTGGGAGGCTGAGACATGTGG - Intronic
1119747787 14:77056731-77056753 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1119827499 14:77669562-77669584 CTTTGGGAGGCTCAGGCAGGTGG + Intergenic
1120551700 14:85880616-85880638 CTTTGGGAGGCACTCTGAAAAGG + Intergenic
1120699447 14:87682415-87682437 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1120812030 14:88813487-88813509 CTTTGGGAGGCTGAGTCAGGCGG - Intergenic
1120840761 14:89083040-89083062 CTGTGGCAGGCTCTGGGAGGGGG + Intergenic
1121130949 14:91446914-91446936 CTTTGGGAGGCTGAGGCATGCGG + Intergenic
1121169164 14:91838387-91838409 CTTTGGGAGGCTGAGGCATGAGG - Intronic
1121184900 14:91958234-91958256 CTTTGGGAGGCCCAGTCAGGAGG + Intergenic
1121191510 14:92034875-92034897 CTTTGGGAGGCTGAGTGTGGAGG - Intronic
1121793365 14:96715824-96715846 CTTTGGGAGGCTGTGGCAGGAGG - Intergenic
1122116232 14:99528595-99528617 CTTTGAGAAGCCCTGGGATGGGG + Intronic
1122440166 14:101726316-101726338 CTTTGGGAGGCTCAGGCAGGTGG + Intergenic
1122581108 14:102772165-102772187 CTTTGGGAGGCTGAGAAATGAGG + Intergenic
1122631301 14:103108930-103108952 CTTTTGGAGATTCTGGGATGTGG + Intronic
1122660719 14:103293223-103293245 CTTTGGGAGGCTGAGGGAGGAGG + Intergenic
1122668142 14:103348509-103348531 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1123188254 14:106540733-106540755 CTTTGGGAGGCTGAGGTATGTGG - Intergenic
1123426863 15:20179318-20179340 CTTTGGGAGGCTGTGGCAGGGGG - Intergenic
1123536095 15:21185845-21185867 CTTTGGGAGGCTGTGGCAGGTGG - Intergenic
1124005092 15:25789202-25789224 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
1124458814 15:29870081-29870103 CTTTGGGAGGCTGGGCGGTGGGG - Intronic
1125438414 15:39673557-39673579 CTTTGGGAGGCTGTGGCAGGAGG - Intronic
1125497143 15:40207358-40207380 CTTTGGGAGGCTGAGGGAGGCGG + Intronic
1125522998 15:40358464-40358486 GTCTGGGAGGGTCTGTGATACGG - Intronic
1125710265 15:41779586-41779608 CTTTGGGAGGCTGTGGCAGGAGG - Intronic
1125936986 15:43645541-43645563 CTTTGGGAGGCTAAGGCATGAGG + Intronic
1125949792 15:43742324-43742346 CTTTGGGAGGCTGAGGTATGAGG + Intergenic
1125979949 15:43991337-43991359 TTCTGTGAGGCTCTGTGATGGGG + Intronic
1126021611 15:44407690-44407712 CTTTGGGAGGCTGAGGGAAGTGG - Intronic
1126121480 15:45256276-45256298 CTTTGGGAGGCTGAGACATGAGG - Intronic
1126135822 15:45390093-45390115 CTTTGGGAGGCTGTGGCAGGCGG - Intronic
1126603787 15:50455319-50455341 CTTTGGGAGGCCCTGGTAGGAGG - Intronic
1126604593 15:50463002-50463024 CTTTGGGAGGCTCAGGAAGGAGG + Intronic
1126616863 15:50591739-50591761 CTTTGGGAGGCTGAGTGGGGAGG - Intronic
1126635658 15:50777386-50777408 CTTTGGGAGGCTGAGGGAGGCGG + Intergenic
1126878969 15:53074025-53074047 CTTTGGGAGGCTAAGTGGGGAGG + Intergenic
1127053777 15:55111612-55111634 CTTTGGGAGGCTAAGTTATGGGG + Intergenic
1127239962 15:57102352-57102374 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1127591945 15:60433732-60433754 CTTTGGGAGGCTGTGGCAGGTGG - Intronic
1127737224 15:61853790-61853812 CTTTGGGAGGCTGAGGCATGCGG + Exonic
1127984571 15:64059848-64059870 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
1128017913 15:64363750-64363772 CTTTGGGAGGCCCAGTCAGGCGG + Intronic
1128069887 15:64788766-64788788 CTTTGGGAGGCTGAGGCATGAGG - Intergenic
1128144557 15:65325579-65325601 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1128202789 15:65823844-65823866 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
1128205567 15:65848835-65848857 CTTTGGGAGGCTAAGTCAGGTGG + Intronic
1128274639 15:66342605-66342627 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1128481566 15:68044631-68044653 CTTTGGGAGGCTGAGTCAGGTGG - Intergenic
1128831117 15:70769751-70769773 TTTTGGGAGGCTGTGTCAGGTGG + Intergenic
1128963775 15:72036974-72036996 CTTTGGGAGGCTCAGGTAGGTGG - Intronic
1129231253 15:74198352-74198374 CTTTGGGAGGCTGAGGCATGAGG - Intronic
1129253561 15:74321506-74321528 CTTTGGGAGGCTAAGGGAGGTGG - Intronic
1129377899 15:75145597-75145619 CCCTGGGAGCCACTGTGATGAGG - Intergenic
1129444907 15:75610152-75610174 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1129569091 15:76659511-76659533 CTTTGGGAGGCTGTGGCAGGAGG - Intronic
1129639889 15:77364708-77364730 GTTTGGGAGCCTCTGTAATAAGG - Intronic
1129640042 15:77366803-77366825 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1129641494 15:77383267-77383289 CTTTGGGAGGCTGAGAGGTGTGG - Intronic
1129748541 15:78042735-78042757 CTTTGTGAGCCTCTGTGTTCCGG - Intronic
1129861488 15:78866211-78866233 CTTTGGGAGGCTGGGGGAGGTGG + Intronic
1130826577 15:87553298-87553320 CTTTGGGAGGCTGACTGAGGCGG - Intergenic
1130951015 15:88588033-88588055 CTTTGGGAGGCTGAGGGAGGAGG + Intergenic
1130999502 15:88928088-88928110 CTTTGGGAGGCTGAGGAATGTGG - Intergenic
1131120373 15:89819128-89819150 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
1131140397 15:89972403-89972425 CTTTGGGAGGCTGTGGCAGGAGG + Intergenic
1131180604 15:90236777-90236799 CTTTGGGAGGCTGAGGGAGGCGG - Intronic
1131456448 15:92585957-92585979 CTGTGGGAGGTTCTGTGAGCTGG + Intergenic
1131530691 15:93189289-93189311 CTTTGGGAGGCTGAGGGAAGGGG - Intergenic
1131819431 15:96257217-96257239 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1132130144 15:99269644-99269666 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
1132587542 16:712181-712203 CTTTGGGAGGCTGTGGCAGGAGG - Intronic
1132753086 16:1467839-1467861 CTTTGGGAGGCTCAGGCAGGAGG + Intronic
1132938066 16:2492081-2492103 CTTTGGGAGGCTCAGGCAGGAGG - Intronic
1133082335 16:3332337-3332359 CTTTGGGAGGCTGAGTCAGGAGG - Intergenic
1133110903 16:3547912-3547934 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1133134786 16:3702797-3702819 CTTTGGGAGGCTGTGGTAGGCGG + Intronic
1133185580 16:4095242-4095264 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1133191841 16:4139577-4139599 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1133588227 16:7216409-7216431 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
1133628379 16:7593524-7593546 CATAGTGAGGCTCTGTGATTAGG - Intronic
1133654482 16:7847173-7847195 CTTTGGGAGGCTGAGTGGGGTGG - Intergenic
1133662837 16:7935560-7935582 CTTTGGGAGGCTGTGGCACGTGG - Intergenic
1133954365 16:10427610-10427632 CTTTGGGAGGCTAAGGCATGAGG + Intronic
1134001475 16:10786328-10786350 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1134004832 16:10811511-10811533 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
1134113848 16:11533468-11533490 CTTTGGGAGGCTGTGGCAGGCGG + Intergenic
1134258624 16:12632083-12632105 CTTTGGGAGGCTGAGGCATGCGG + Intergenic
1134284200 16:12846052-12846074 CTTTGGGAGGCTGAGTCAGGTGG - Intergenic
1134295935 16:12945868-12945890 CTTTGGGAGGCTCAGACAGGTGG + Intronic
1134310442 16:13071334-13071356 GGTTGGCAGGCTCTCTGATGAGG + Intronic
1134514780 16:14878248-14878270 CTTTGGGAGGCCCAGGCATGTGG + Intronic
1134563255 16:15228804-15228826 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1134585023 16:15402922-15402944 CTTTGGGAGGCTGAGGGAGGCGG - Intronic
1134636393 16:15795058-15795080 CTTTGGGAGGCTGACTGAGGTGG + Intronic
1134652788 16:15924023-15924045 CTTTGGGAGGCTGAGGTATGAGG - Intergenic
1134683627 16:16143771-16143793 CTTTGGGAGGCTCAGGCAGGAGG - Intergenic
1134702457 16:16276906-16276928 CTTTGGGAGGCCCAGGCATGTGG + Intronic
1134901037 16:17938221-17938243 CTTTGGGAGGCTCAGGCAGGAGG + Intergenic
1134923782 16:18140433-18140455 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1134965086 16:18435209-18435231 CTTTGGGAGGCCCAGGCATGTGG - Intronic
1134969373 16:18517744-18517766 CTTTGGGAGGCCCAGGCATGTGG - Intronic
1135118097 16:19740725-19740747 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1135286230 16:21195710-21195732 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1135343604 16:21669098-21669120 CTTTGGGAGCCTGTGTCAGGTGG + Intergenic
1135348470 16:21709186-21709208 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1135457880 16:22614507-22614529 CTTAGGGAGGCTTTGTACTGTGG + Intergenic
1135535818 16:23293681-23293703 CTTTGGGAGGCTGAGACATGAGG + Intronic
1135588466 16:23689125-23689147 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1135646015 16:24162695-24162717 CTTTGGGAGGCTGAGGTATGGGG - Intronic
1135805574 16:25539416-25539438 CTTTGGGAGGCTGTGGCAGGAGG - Intergenic
1135862204 16:26066943-26066965 CATTGGCAGGGTCTGTGCTGTGG + Intronic
1135980139 16:27140979-27141001 CTTTGGGAGGCTGAGGGAGGAGG - Intergenic
1136122598 16:28148796-28148818 CTTTGGGAGGCTGAGTCAAGTGG + Intronic
1136132361 16:28231393-28231415 CTTTGGGAGGCTGAGGCATGCGG - Intergenic
1136176422 16:28520124-28520146 CTTTGGGAGGCTGAGAAATGTGG + Intergenic
1136372153 16:29843246-29843268 CTTTGGGAGGCTGTGGCAGGAGG + Intronic
1136467793 16:30457005-30457027 CTTTGGGAGGCTGAGGGAGGCGG + Intergenic
1136519296 16:30786027-30786049 CTTTGGATGGCTGTGTGAGGTGG + Intronic
1136527333 16:30840459-30840481 CTTTGGGAGGCTGTGGCAGGTGG - Intronic
1136555353 16:31004428-31004450 CTTTGGGAGGCTCTGGTGGGAGG + Intronic
1136557861 16:31018946-31018968 CTTTGGGAGGCTGAGTTAGGAGG + Intergenic
1136561847 16:31043762-31043784 CTTTGGGAGGCCCTGGCAGGTGG + Intergenic
1136619788 16:31420819-31420841 CTTTGGGAGGCCCTCGGGTGGGG - Intronic
1136689091 16:32015611-32015633 CTTTGGGAGGCTGAGTTAGGCGG + Intergenic
1136789683 16:32959122-32959144 CTTTGGGAGGCTGAGTTAGGCGG + Intergenic
1136846190 16:33577920-33577942 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1136880129 16:33894811-33894833 CTTTGGGAGGCTGAGTTAGGCGG - Intergenic
1137283396 16:46996950-46996972 CTTTGGGAGGCTGAGGGAGGAGG + Intergenic
1137436278 16:48456346-48456368 CTTTGGGAGGCTAAGAGAGGAGG - Intergenic
1137970672 16:52981602-52981624 CTTTGGGAGGCTGAGGCATGCGG - Intergenic
1138114861 16:54352233-54352255 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1138487333 16:57354913-57354935 CTTTGGGAGGCCCTGGAAGGCGG - Intergenic
1138494087 16:57396677-57396699 TTTTTGGAGGCTCTGAGAAGCGG + Intergenic
1138666548 16:58574005-58574027 CTTTGGGAGGCTGTGGCAGGAGG + Intronic
1138671369 16:58617760-58617782 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1138983576 16:62299546-62299568 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1139283876 16:65793345-65793367 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1139381010 16:66530964-66530986 CTTTGGGAGGCTGAGGCATGCGG - Intronic
1139455568 16:67072954-67072976 CTTTGGGAGGCTGTGGCAGGAGG - Intronic
1139608664 16:68038953-68038975 CTTTGGGAGGCTGAGGCATGAGG + Intronic
1139688447 16:68622599-68622621 CTTTGGGAGGCTAAGTCAGGAGG + Intergenic
1139828690 16:69778882-69778904 CTTTGGGAGGCTCAGGCATGCGG - Intronic
1139877913 16:70161166-70161188 CTTTGGGAGGCCCAGTGAGGTGG + Exonic
1139897847 16:70302162-70302184 CTTTGGGAGGCTGAGGCATGCGG - Intronic
1140075822 16:71698088-71698110 CTTTGGGAGGCTGTGGCAGGCGG - Intronic
1140194969 16:72848199-72848221 CTTGGGGATGCTGTGTGGTGTGG + Intronic
1140361453 16:74347779-74347801 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1140477921 16:75248283-75248305 ATGTGCGAGGCTCTGTGCTGGGG - Intronic
1140492606 16:75351762-75351784 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
1140520983 16:75581490-75581512 CTTTGGGAGGCTGAGGTATGTGG + Intergenic
1140647886 16:77052776-77052798 CTTTGGGAGGCTGTGGCAGGAGG + Intergenic
1140758900 16:78093307-78093329 CTTTGAGAGGCTCAGTCAGGAGG + Intergenic
1141092296 16:81138575-81138597 CTTTGGGAGGCTGAGGTATGTGG - Intergenic
1141275250 16:82581770-82581792 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
1141624881 16:85255929-85255951 CTTTGGGAGGCTGTGGTAGGAGG - Intergenic
1141719468 16:85747842-85747864 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
1141752659 16:85969506-85969528 CCTTGTGAGGTTCTGTGATTTGG + Intergenic
1142130586 16:88429996-88430018 CGTTGAGCGCCTCTGTGATGAGG - Exonic
1142179952 16:88663517-88663539 CTGTGTGAGGCGCTGTGCTGGGG + Intergenic
1142389304 16:89788217-89788239 CTTTGGGAGGCTAAGTGGGGCGG + Intronic
1142449198 16:90164699-90164721 CTTTGGGAGGCTAAGAGAGGAGG + Intergenic
1203091885 16_KI270728v1_random:1220593-1220615 CTTTGGGAGGCTGAGTTAGGCGG + Intergenic
1203107898 16_KI270728v1_random:1426574-1426596 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1203140297 16_KI270728v1_random:1760506-1760528 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
1142457897 17:67182-67204 CTTTGGGAGGCTAAGAGAGGAGG - Intergenic
1142458290 17:70602-70624 CTTTGGGAGGCTAAGAGAGGAGG - Intergenic
1142579729 17:934200-934222 CTTTGGGAGGCTCAGGCAGGCGG + Intronic
1142679321 17:1536834-1536856 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1142724813 17:1805171-1805193 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1142761831 17:2046828-2046850 CTTTGGGAGGCTAAGGCATGAGG + Intergenic
1142836450 17:2591503-2591525 CTTTGGGAGGCTCAGACAGGTGG - Intergenic
1142839296 17:2614269-2614291 CTTTGGGAGGCTGAGGCATGAGG - Intronic
1142965461 17:3578059-3578081 CTTTGGGAGGCTGAGGCATGCGG + Intronic
1143552478 17:7639429-7639451 CTTTGGGAGGCTGAGTGGGGAGG - Intergenic
1143614313 17:8040299-8040321 CTTTGGGAGGCTGAGGGAGGCGG + Intronic
1143630398 17:8136230-8136252 CTTTGGGAGGCTGGGTGGGGGGG + Intergenic
1143646552 17:8234216-8234238 CTTTGGGAGGCTAAGGCATGAGG - Intronic
1143801973 17:9390582-9390604 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1144243329 17:13335815-13335837 CTTTGGGAGGCTGAGGTATGTGG + Intergenic
1144248578 17:13393421-13393443 CCTGGGCAGGCTCTGGGATGAGG + Intergenic
1144528894 17:16016935-16016957 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
1144539951 17:16131267-16131289 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1144751236 17:17649566-17649588 CTTTGGGAGGCTGTGGTAGGAGG + Intergenic
1144782020 17:17813210-17813232 CTTTGGGAGGCTCAGTTGGGAGG - Intronic
1144856886 17:18274178-18274200 CTTTGGGAGGCTGTGGGGGGCGG - Exonic
1145083379 17:19914405-19914427 CTTTGGGAGGCTGAGAGATGTGG + Intronic
1145116263 17:20213336-20213358 CTTTGGGAGGCACTGAGGTGTGG - Intronic
1145201676 17:20951127-20951149 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1145372403 17:22317835-22317857 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
1145414880 17:22706742-22706764 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1145753492 17:27372764-27372786 CTTTGGGAGGCTCTGGTGGGTGG - Intergenic
1145773358 17:27509265-27509287 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1145793094 17:27639977-27639999 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1145915271 17:28570265-28570287 CTTTGGGAGGCTGAGGCATGCGG + Intronic
1145940243 17:28739688-28739710 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1145982985 17:29025054-29025076 CTTTGGGAGGCTGAGAGGTGCGG + Intronic
1146172231 17:30643041-30643063 CTTTGGGAGGCTCAGGCAGGCGG + Intergenic
1146295164 17:31643866-31643888 CTTTGGGAGGCTCAGGCAGGTGG - Intergenic
1146320310 17:31841613-31841635 CTTTGGGAGGCTGTGGCAGGCGG + Intergenic
1146329265 17:31914426-31914448 CTTTGGGAGGCTTAGTGGGGTGG + Intergenic
1146345688 17:32059079-32059101 CTTTGGGAGGCTCAGGCAGGCGG + Intergenic
1146363398 17:32197814-32197836 CTTTGGGAGGCTGTGGCAGGTGG - Intronic
1146364022 17:32204742-32204764 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
1146404814 17:32528078-32528100 CTTTGGGAGGCTGAGGTATGTGG - Intronic
1146624366 17:34424538-34424560 CTCTGGGAGGTGCTGGGATGAGG - Intergenic
1146718892 17:35109108-35109130 CTTTGGGAGGCTGTGTTGGGCGG - Intronic
1146770027 17:35560569-35560591 CTTTGGGAGGCTCAGGTAGGTGG - Intergenic
1146775343 17:35609588-35609610 CTTTGGGAGGCCATGTCAGGTGG - Intronic
1147002142 17:37371320-37371342 CTTTGGGAGGCTGAGTTAGGTGG - Intronic
1147002378 17:37373120-37373142 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
1147177568 17:38665678-38665700 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1147220677 17:38927797-38927819 CTTTGGGAGGCTCAGGCAGGAGG + Intergenic
1147246223 17:39122810-39122832 TTTTGGGAGGCAGTGTGATATGG + Intronic
1147370839 17:39991794-39991816 CTTTGGGAGGCTGTGGCAAGAGG + Intronic
1147400909 17:40179461-40179483 CTTTGGGAGGCCGTGGGGTGGGG - Intronic
1147714047 17:42492123-42492145 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1147749086 17:42716939-42716961 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
1147788390 17:42996859-42996881 CTTTGGGAGGCTCAGGTAGGAGG + Intergenic
1147867781 17:43564930-43564952 CTATGTGAGGCTCTCTGAGGTGG - Intronic
1148000399 17:44384280-44384302 CTTCGGGAGGCCCAGTGGTGGGG + Intronic
1148034827 17:44651969-44651991 CTTTGGGAGGCTGAGTGGGGAGG + Intergenic
1148107218 17:45125217-45125239 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1148132839 17:45272694-45272716 CTTTGGGAGGCTGAGTGGGGCGG + Intronic
1148179656 17:45595118-45595140 CTTTGGGAGGCTCAGGCAGGAGG - Intergenic
1148269248 17:46250783-46250805 CTTTGGGAGGCTCAGGCAGGAGG + Intergenic
1148292382 17:46465164-46465186 CTTTGGGAGGCTCAGGCAGGAGG - Intergenic
1148314566 17:46682856-46682878 CTTTGGGAGGCTCAGGCAGGAGG - Intronic
1148520071 17:48265260-48265282 CTTTGGGAGGCTGAGGGAGGCGG + Intronic
1148569963 17:48660343-48660365 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1148901399 17:50881008-50881030 CTTTGGGAGGCTGGGGGAGGGGG - Intergenic
1149126139 17:53235754-53235776 CTTTGGGAGGCCAAGTGAGGAGG + Intergenic
1149137665 17:53388909-53388931 CTTTGGGAGGCTGAGGCATGCGG - Intergenic
1149194299 17:54101700-54101722 CTTTGGGAGGCTGAGTGGGGTGG + Intergenic
1149215911 17:54354238-54354260 CTTTGGGAGGCTCAGGCAGGCGG + Intergenic
1149263291 17:54901324-54901346 CTCTGGGAGACTAAGTGATGTGG + Intronic
1149347506 17:55752992-55753014 CTTTGGGAGGCTGAGGGCTGAGG - Intronic
1149719176 17:58826043-58826065 CTTTGGGAGGCTGAGTGAGGCGG + Intronic
1149739912 17:59035302-59035324 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1149806952 17:59627142-59627164 CTTTGGGAGGCTGTGGCAGGTGG - Intronic
1149858426 17:60106047-60106069 CTTTGGGAGGCTCAGACAGGAGG - Intergenic
1149881612 17:60297682-60297704 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1150117143 17:62562874-62562896 CTTTGGGAGGCTCAGGGAGGAGG + Intronic
1150209375 17:63433831-63433853 CCCTGGGAAGCTCTGAGATGAGG - Exonic
1150274165 17:63885181-63885203 CTTTGGGAGGCTGAGACATGTGG + Intergenic
1150276316 17:63899986-63900008 CTTTGGGAGGCTGAGACATGTGG + Intergenic
1150365330 17:64577836-64577858 CTTTGGGAGGCTGAGGCATGAGG - Intronic
1150572243 17:66397206-66397228 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
1150666323 17:67142261-67142283 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
1150674740 17:67235102-67235124 CTTTGAGAAGCTCTGTTCTGAGG - Intronic
1151160566 17:72161640-72161662 CTTTGGGAGGCCCTGGCAGGCGG + Intergenic
1151189613 17:72388705-72388727 CTTTGGGAGGCTGTGGCAGGTGG - Intergenic
1151350113 17:73526878-73526900 CTTTGAGATCCTCTGTGTTGAGG - Intronic
1151446501 17:74168998-74169020 CTTTGGGAGGCTGTGGCAGGTGG + Intergenic
1151543097 17:74775430-74775452 CTTTGGGAGGCTGTGGCAGGAGG - Intronic
1151690561 17:75681863-75681885 ATTTAGGAGGGTATGTGATGTGG + Intronic
1151695247 17:75712241-75712263 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1151741656 17:75987065-75987087 CTTTGGGAGGCTGAGTCAGGAGG - Intronic
1151840136 17:76611754-76611776 CTTTGGGAGGCTGTGGAAGGAGG + Intergenic
1151905585 17:77046403-77046425 CTTTGGGAGGCTGAGGCATGAGG + Intergenic
1151911012 17:77083362-77083384 CTTTGGGAGGCTCAGGCAGGTGG - Intergenic
1151944317 17:77311232-77311254 CCTAGGGAGGCTCTGGGGTGGGG - Intronic
1151995460 17:77605934-77605956 CTTTGGGAGGCTCAGGCAGGCGG - Intergenic
1152774506 17:82192226-82192248 CTTTGGGAGGCTGAGTCAGGGGG - Intronic
1153041566 18:817403-817425 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
1153112206 18:1605021-1605043 CTTTGCTAGGATCTCTGATGAGG - Intergenic
1153293927 18:3527834-3527856 CTTTGGGAGGCCATGCCATGAGG - Intronic
1153316774 18:3730142-3730164 CTTTGGGAGGCTGTGGCAGGAGG + Intronic
1153701679 18:7700745-7700767 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
1153898387 18:9591102-9591124 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
1153907233 18:9672981-9673003 CTTTGGGAGGCTGAGGCATGGGG + Intergenic
1154018253 18:10638846-10638868 TTCTGGGAGTCACTGTGATGAGG - Intergenic
1154032109 18:10762903-10762925 CTTGGTGAGCCTCGGTGATGGGG - Exonic
1154186619 18:12190736-12190758 TTCTGGGAGTCACTGTGATGAGG + Intergenic
1154211067 18:12378507-12378529 CTTTGGGAGGCTGAGTCAGGAGG - Intergenic
1154212589 18:12392781-12392803 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1154236982 18:12615079-12615101 CTTTGGGAGGCTGAGGCATGCGG + Intronic
1154242713 18:12667215-12667237 CTTTGGGAGGCTGAGTGAGGAGG + Intronic
1154252174 18:12753844-12753866 CTTTGGGAGGCTCAGATAGGAGG - Intergenic
1154324653 18:13381309-13381331 CTTTGGGAGGCTGTGGCAGGAGG - Intronic
1154361653 18:13667785-13667807 CTTTGGGAGGCTCAGTCGGGAGG + Intronic
1154372766 18:13779656-13779678 CTTTGGGAGGCTCAGGCAGGTGG + Intergenic
1154468250 18:14670554-14670576 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1154471750 18:14709955-14709977 CTTTGGCAGGCTGTGGCATGTGG + Intergenic
1155267689 18:24109759-24109781 CTTTGGGAGGCTGAGGGAGGCGG + Intronic
1155274245 18:24170889-24170911 CTTTGGGAGGCTGAGTGGGGAGG - Intronic
1155511065 18:26577815-26577837 CTTTGGGAGGCTCAGGCAGGAGG - Intronic
1155628435 18:27863111-27863133 GTTTGGGAGGCAGCGTGATGTGG + Intergenic
1155656375 18:28197129-28197151 CTTTGGGAGGCTCAGGCAGGAGG + Intergenic
1156002769 18:32403682-32403704 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1156226276 18:35112412-35112434 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1156792293 18:40990300-40990322 CTTTGGGAGGCTGAGGCATGGGG - Intergenic
1156906738 18:42361900-42361922 CTTTGGGAGGCTGAGTCAGGAGG - Intergenic
1157348503 18:46862947-46862969 CTTTGGGAGGCTCTGGTGGGTGG - Intronic
1157425212 18:47578762-47578784 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1157526061 18:48383507-48383529 CTTTGGGAGGCTCAGGCAGGCGG - Intronic
1157648589 18:49303650-49303672 CTGTGGGAAGCACTGTCATGTGG - Intronic
1157671572 18:49533639-49533661 CTTTGGGAGGCTGTGGCAGGCGG - Intergenic
1157674264 18:49557070-49557092 CTTTGGGAGGCCCAGTCAGGAGG + Intergenic
1157859345 18:51126453-51126475 CTTTGGGAGGCTGAGGGAGGAGG + Intergenic
1157956411 18:52102266-52102288 CTTTGGGAGGCTGTGGCAGGTGG - Intergenic
1158397356 18:57089689-57089711 CTTTGGGAAGCACAGTGATGGGG - Intergenic
1158476624 18:57785747-57785769 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1158521183 18:58172314-58172336 CTTTTAGACGCTCTGTGGTGGGG + Intronic
1158714134 18:59862916-59862938 CTTTGGGAGGCTCAGGCAGGAGG + Intergenic
1158847859 18:61463593-61463615 CTTTGGGAGGCTGTGCGTTGGGG + Intronic
1159173133 18:64798646-64798668 CTTTGGGAGGCTGTGTCGGGTGG + Intergenic
1159175476 18:64828250-64828272 CTTTGAGAGGCTCAGTAATTCGG - Intergenic
1159588327 18:70303548-70303570 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
1159617449 18:70598144-70598166 CTTTGGGAGGCTGAGTTGTGTGG - Intergenic
1160460912 18:79037412-79037434 CCTTGGAAGGCTCTGAGATATGG - Intergenic
1160648008 19:203108-203130 CTTTGGGAGGCTAAGAGAGGAGG - Intergenic
1160667345 19:337621-337643 CTTTGGGAGGCTCAGGCAGGCGG + Intronic
1160798831 19:957865-957887 CTTTGGGAGGCTGTGGCAGGCGG + Intronic
1160823814 19:1070235-1070257 CTTTGGGAGGCTGAGGCATGCGG - Intronic
1161042602 19:2117914-2117936 CTTTGGGAGGCTGTGGAGTGTGG + Intronic
1161272212 19:3396226-3396248 CTTTGGGAGGCTGAGGTATGCGG + Intronic
1161305095 19:3563107-3563129 CTTTGGGAGGCTGTGGCAGGCGG - Intronic
1161337803 19:3723546-3723568 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
1161549602 19:4904558-4904580 CTTTGGGAGGCCAAGTGAGGCGG - Intronic
1161612148 19:5249065-5249087 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1161688112 19:5713804-5713826 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1161812327 19:6477818-6477840 CTTTGGGAGGCTGAGGCATGCGG + Intronic
1161839751 19:6672390-6672412 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1161922851 19:7279561-7279583 CTTTGGGATACTCAGGGATGTGG + Intronic
1161927980 19:7315566-7315588 CTTTGGGAGGCTGAGAGAGGTGG + Intergenic
1162056619 19:8068141-8068163 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
1162066700 19:8130139-8130161 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
1162149917 19:8637661-8637683 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1162197007 19:8992678-8992700 CTTTGGGAAGCTGAGGGATGAGG - Intergenic
1162207583 19:9067277-9067299 CTTTGGGAGGCTGGGTCAGGTGG + Intergenic
1162269913 19:9605774-9605796 CTTTGGGAGGCTGGGTCAGGAGG - Intronic
1162340194 19:10087160-10087182 CTTGGGGAGGCTCTGCGTCGCGG + Intronic
1162370609 19:10276726-10276748 CTTTGGGAGGCTGAGGGAGGCGG + Intronic
1162387926 19:10371395-10371417 CTTTGGGAGGCTGAGGGAGGCGG + Intronic
1162466678 19:10845933-10845955 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1162481771 19:10931184-10931206 CTTTGGGAGGCCCAGTCAGGTGG + Intronic
1162510128 19:11113070-11113092 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1162537916 19:11274872-11274894 CTTTGGGAGGCTAAGGGAGGAGG + Intergenic
1162542146 19:11303616-11303638 CTTTGGGAGGCTGAGTTAGGAGG - Intronic
1162570837 19:11471695-11471717 CTTTGGGAGGCTGAGGCATGAGG - Intronic
1162655455 19:12125667-12125689 CTTTGGGAGGCGCAGTCAAGCGG + Intronic
1162673524 19:12279275-12279297 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
1162696847 19:12483395-12483417 CTTTGGGAGGCTGAGTCAGGAGG - Intronic
1162812948 19:13175543-13175565 CTTTGGGAGGCCCAGGCATGAGG + Intergenic
1162880222 19:13653350-13653372 CTTTGGGAGGCTGGGGCATGAGG + Intergenic
1162902352 19:13802820-13802842 CTTTGGGAGGCTGTGGCAGGAGG - Intronic
1162911172 19:13848374-13848396 CTTTGGGAGGCTGTGGCAGGAGG + Intergenic
1162938276 19:13992886-13992908 CTTTGGGAGGCTATGGCAGGAGG + Intronic
1162950204 19:14067533-14067555 CTTTGGGAGGCTGTGGCAGGAGG - Intergenic
1162990190 19:14296990-14297012 CTTTGGGAGGCTCAGGCAGGCGG - Intergenic
1163087126 19:14989729-14989751 CTTTGGGAGGCTGAGTGGGGTGG + Intronic
1163115447 19:15186205-15186227 CTTTGGGAGGCTGAGACATGAGG - Intronic
1163128680 19:15258525-15258547 CTTTGGGAGGCTGTGGCAAGTGG - Intronic
1163139163 19:15334491-15334513 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1163161388 19:15466575-15466597 CTTTGGGAGGCTGAGGCATGAGG - Intergenic
1163257251 19:16164216-16164238 CTTTGGGAGGCTAAGTGGGGAGG - Intronic
1163258102 19:16170040-16170062 CTTTGGGAGGCTAAGTCAGGTGG - Intronic
1163267604 19:16230640-16230662 CTTTGGGAGGCTGAGTCAGGCGG - Intronic
1163285784 19:16346762-16346784 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1163531183 19:17849811-17849833 CTTTGGGAGGCTCAGGCAGGAGG + Intergenic
1163604784 19:18268039-18268061 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
1163626800 19:18394832-18394854 CTTTGGGAGGCTAAGACATGAGG + Intronic
1163672659 19:18637638-18637660 CTGTGGGAGGCTCTGGGTGGGGG + Intronic
1163687998 19:18723182-18723204 CTTTGGGAGGCTGTGGCAGGTGG - Intronic
1163716144 19:18873451-18873473 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
1163716773 19:18877506-18877528 CTTTGGGAGGCTAAGGCATGTGG + Intronic
1163729012 19:18939194-18939216 CTTTGGGAGGCTGAGTCAGGAGG + Exonic
1163780028 19:19241317-19241339 CTTTGGGAGACTGAGTGAGGAGG + Intronic
1163865816 19:19772546-19772568 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
1163926411 19:20348670-20348692 CTTTGGGAGGCTTTGGCAGGTGG + Intergenic
1163951804 19:20595443-20595465 CTTTGGGAGGCTGAGGCATGAGG + Intronic
1164138350 19:22434392-22434414 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
1164267105 19:23629838-23629860 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1164283203 19:23787357-23787379 CTTTGGGAGGCTGAGGGAAGTGG + Intronic
1164309371 19:24032860-24032882 CTTTGGGAGGCTCTGGCGGGCGG + Intergenic
1164560564 19:29289152-29289174 CTTTGGGAGGCTGAGGGAGGAGG + Intergenic
1164742025 19:30583004-30583026 CTTTGGGAGGCTGAGTTAGGAGG - Intronic
1164940241 19:32246857-32246879 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1164970053 19:32524130-32524152 CTTTGGGAGGCTGAGGTATGTGG - Intergenic
1165004974 19:32797222-32797244 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
1165031954 19:33004281-33004303 CTTTGGGAGGCTGAGTCAGGAGG - Intronic
1165042268 19:33077277-33077299 CTTTGGGAGGCCATGTAAGGAGG - Intergenic
1165117049 19:33534846-33534868 CTTTGGGAGGCCATGGGAGGAGG + Intergenic
1165399590 19:35589477-35589499 CTTTGGGAGGCTGAGAGAGGAGG + Intergenic
1165651707 19:37496734-37496756 CTTTGGGAGGCTCAGGCAGGCGG + Intergenic
1165652471 19:37503326-37503348 CTTTGGGAGGCTGAGGCATGCGG + Intergenic
1165660342 19:37573581-37573603 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1165674372 19:37708617-37708639 CTTTGGGAGGCCCTGAGGTCAGG + Intronic
1165681927 19:37784454-37784476 CTTTGGGAGGCTGAGGCATGAGG + Intronic
1165786130 19:38463149-38463171 CTTTGGGAGGCTAAGTGGGGGGG - Intronic
1165798054 19:38530511-38530533 CTTTGGGAGGCTGAGTGGGGAGG - Intronic
1165815381 19:38638793-38638815 CTTTGGGAGGCTAAGGGAGGAGG + Intergenic
1165888060 19:39093495-39093517 CTTTGGGAGGCTCAGGAAGGTGG - Intronic
1165944269 19:39432133-39432155 CTTTGGGAGGCTGTGGCAGGAGG + Intergenic
1166012646 19:39954220-39954242 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1166012957 19:39957275-39957297 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1166013134 19:39958748-39958770 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1166053805 19:40276770-40276792 CTTTGGGAGGCTGAGGGATGTGG + Intronic
1166114267 19:40643282-40643304 CTTTGGGAGGCTATGGCAGGAGG + Intergenic
1166174962 19:41061290-41061312 CTTTGGGAGGCTGAGTGGGGTGG - Intergenic
1166199789 19:41229506-41229528 CTTTGGGAGGCTGAGTCAGGAGG - Intronic
1166212250 19:41314383-41314405 CTTTGGGAGGCTGTGGCAGGTGG - Intronic
1166221617 19:41368651-41368673 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
1166463051 19:43006514-43006536 CTTTGGGAGGCTGAGGCATGCGG + Intronic
1166549186 19:43653880-43653902 CTTTGGGAGGCTGAGTCAGGCGG + Intronic
1166575011 19:43829140-43829162 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
1166756632 19:45196475-45196497 CCTTGGCAGGCTCAGTGCTGTGG - Intronic
1166813882 19:45529975-45529997 CTTTGGGAGGCTTTGGCAGGAGG - Intronic
1166999635 19:46738323-46738345 CTGGGGGAGGCCCTGTGATTTGG - Intronic
1167083843 19:47295623-47295645 CTTTGGGAGGCTCAGACAGGCGG + Intronic
1167170458 19:47827764-47827786 CTTTGGGAGGCTGAGTTATGAGG - Intronic
1167171497 19:47835299-47835321 CTTTGGGAGGCTGAGTCAGGCGG - Intronic
1167221011 19:48198021-48198043 CTTTGGGAGGCTGTGGCAGGAGG - Intronic
1167286312 19:48600575-48600597 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1167316107 19:48763752-48763774 CTTTGGGAGGCTGAGTGGGGAGG + Intergenic
1167348152 19:48959569-48959591 CTTTGGGAGGCTGAGGCATGCGG + Intronic
1167450009 19:49561636-49561658 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
1167563456 19:50240691-50240713 CTTTGGGAGGCCAAGTGAGGAGG + Intronic
1167656517 19:50767890-50767912 CTTTGGGAGGCTGAGAGGTGCGG - Intergenic
1167693750 19:51002288-51002310 GTTTGGGAGGCACTGTGACCTGG + Intronic
1167796761 19:51714304-51714326 CTTTGGGAGGCTGAGGGATAAGG + Intronic
1167941890 19:52954142-52954164 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
1167993138 19:53377801-53377823 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1168020815 19:53607313-53607335 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
1168304358 19:55427236-55427258 CTTTGGGAGGCTGAGGTATGAGG - Intergenic
1168331683 19:55573708-55573730 CTTTGGGAGGCTGAGTGGGGAGG + Intergenic
1168331941 19:55575547-55575569 CTTTGGGAGGCTGTGGCAGGAGG + Intergenic
1168392914 19:56025651-56025673 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1168447069 19:56428349-56428371 CTTTGGGAGGCTGAGGGAAGAGG - Intronic
1168454248 19:56493549-56493571 CATTGGGTGCCTCTGTGTTGAGG + Intergenic
1168616319 19:57839835-57839857 CTTTGGGAGGCCCTGGCAGGTGG + Intronic
1168617217 19:57848343-57848365 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
1168620549 19:57876197-57876219 CTTTGGGAGGCCCTGGCAGGTGG - Intronic
925011998 2:493025-493047 ATTTAGGGTGCTCTGTGATGGGG - Intergenic
925039725 2:722372-722394 CTTTGGGAGGCTGAGTGGGGTGG - Intergenic
925567167 2:5268839-5268861 CTTTGGGAGGCTGAGGGAGGCGG + Intergenic
925598484 2:5583717-5583739 CTTTGGGAGGCTGAGGTATGCGG + Intergenic
926110730 2:10182007-10182029 CTTTGGGAGGCTGAGGAATGAGG - Intronic
926138090 2:10351512-10351534 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
926433474 2:12814921-12814943 CTTTGGGAGGCTGAGGCATGCGG - Intergenic
926658288 2:15434512-15434534 ATTTGGGAGACTTTTTGATGTGG - Intronic
926706034 2:15838185-15838207 CTTTGGGAGGCTCAGGCAGGTGG + Intergenic
926911753 2:17858028-17858050 CTTTGGGAGGCTAAGTCAGGAGG - Intergenic
927164610 2:20305239-20305261 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
927247318 2:20967859-20967881 CTTTGGGAGGCTGAGTTGTGTGG + Intergenic
927326485 2:21811313-21811335 CTTTGGGAGGCTGTGGCAGGTGG - Intergenic
927575997 2:24202179-24202201 CTTTGGGAGGCTCAGGCAGGCGG + Intergenic
927715061 2:25346454-25346476 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
927780251 2:25933425-25933447 CTTTGGGAGGCTGAGGCATGTGG + Intronic
927901621 2:26823545-26823567 CTTTGGGAGGCTGAGTGGGGAGG + Intergenic
927929022 2:27032413-27032435 CTTTGGGAGGCTGAGGGGTGGGG + Intergenic
927932987 2:27057642-27057664 CTAGGGGATTCTCTGTGATGTGG - Intronic
927984549 2:27399427-27399449 CTTTGGGAGGCCCAGGGAGGCGG + Intronic
927993751 2:27467327-27467349 CTTTGGGAGGCTCAGGCAGGAGG + Intronic
928141445 2:28732864-28732886 CTTTGGGAGGCTCAGGTAGGAGG - Intergenic
928221123 2:29403630-29403652 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
928456540 2:31427804-31427826 CTTTGGGAGGCTGAGACATGTGG - Intergenic
928620380 2:33082666-33082688 CTTTGGGAGGCTGTGGCAGGCGG - Intronic
928861855 2:35867865-35867887 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
929105016 2:38356434-38356456 CTTTGGGAGGCTGAGTGAGGTGG - Intronic
929352745 2:40979489-40979511 CTTTGGGAGTTTCTTTAATGTGG + Intergenic
929441799 2:41970879-41970901 CTTTGAAAGGCCCTGTGATATGG - Intergenic
929492649 2:42409458-42409480 CTTTGGGAGGCTGAGGCATGAGG + Intronic
929524855 2:42692668-42692690 CTTTGGGAGGCTGTGGCAGGAGG - Intronic
929650396 2:43674739-43674761 CTTTGGGAGGCTGAGGCATGTGG + Intronic
929673834 2:43904183-43904205 CTTTGGGAGGCTGTGGCAGGAGG - Intronic
929682030 2:44001022-44001044 CTTTGGGAGGCTGTGGCAGGCGG - Intergenic
929682139 2:44002610-44002632 CTTTGGGAGGCTGTGGCAGGTGG + Intergenic
930012741 2:46949780-46949802 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
930643096 2:53874695-53874717 CTTTGGGAGGATGAGTGAGGTGG + Intronic
930696203 2:54414175-54414197 ATTTTGGTGTCTCTGTGATGTGG - Intergenic
930800859 2:55441203-55441225 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
931342792 2:61417982-61418004 CTTTGGGAGGCCCAGGGAGGTGG - Intronic
931459417 2:62437284-62437306 CTTTGGGAGGCTAAGGGAGGAGG + Intergenic
931783919 2:65602145-65602167 CTTTGGGAGGCTGAGGCATGCGG + Intergenic
932152291 2:69384472-69384494 CTTTGGGAGGCTGTGGTAGGTGG + Intronic
932236667 2:70125855-70125877 CTTTGGGAGGCTGTGGCAGGAGG - Intergenic
932339906 2:70956826-70956848 CTTTGGGAGGCTGAGGCATGTGG - Intronic
932346412 2:70998490-70998512 CTTTGGGAGGCTGTGGCAGGAGG - Intergenic
932778565 2:74544887-74544909 CCCTGGGAGATTCTGTGATGGGG - Intronic
933025192 2:77249104-77249126 CTTTGGGAGGCTGAGGCATGTGG + Intronic
933238760 2:79896037-79896059 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
933517375 2:83322351-83322373 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
933726874 2:85431946-85431968 CTTTGGGAGGCGAGGTAATGGGG + Intronic
933804698 2:85989597-85989619 CTTTGGGAGGCTGAGTCAGGAGG - Intergenic
933866803 2:86526810-86526832 CTTTGGGAGGCTGTGGCAGGAGG - Intronic
934295290 2:91738116-91738138 CTTTGGGAGGCTGAGGGAGGCGG - Intergenic
934485050 2:94699192-94699214 CTTTGGGAGGCTGGGACATGCGG - Intergenic
935044094 2:99463865-99463887 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
935198990 2:100839370-100839392 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
935278222 2:101494311-101494333 CTTTGGGAGGCTGAGTGGGGAGG - Intergenic
935298035 2:101667587-101667609 CTTTGGGAGGCCCTGGCAGGAGG - Intergenic
935312415 2:101798154-101798176 CTTTGGGAGGCTGAGACATGAGG - Intronic
935388725 2:102528249-102528271 CTTTGGGAGGCTGAGTCAGGGGG - Intronic
935410196 2:102753612-102753634 CTTTGGGAGGCTGTGGAAGGAGG - Intronic
935460607 2:103328731-103328753 CTTTGGGAGGCTTTGGCAGGTGG - Intergenic
935587095 2:104810989-104811011 CTTTGGGAGGCTGAGTTAGGAGG + Intergenic
935664833 2:105501663-105501685 CTTTGGGAGGCTGTGGCAGGTGG + Intergenic
935679455 2:105623220-105623242 CTTTGGGAGGCTCTGGTGGGTGG + Intergenic
935706468 2:105861756-105861778 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
936031494 2:109074777-109074799 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
936366905 2:111865960-111865982 CTTTGGGAGGCTGAGTCAGGCGG + Intronic
936512871 2:113162500-113162522 CTTTGGGAGGCTGGCTGAGGTGG - Intronic
936554168 2:113478522-113478544 CTTTGGGAGGCTGAGGCATGAGG - Intronic
936847829 2:116858044-116858066 CTTTGGGAGGCTCAGGCAAGTGG + Intergenic
936892158 2:117384227-117384249 CTTTGGGAGGCTGAGGCATGCGG - Intergenic
937036785 2:118788783-118788805 CTTTGGGAGGCTCTGGTGGGTGG - Intergenic
937145000 2:119637078-119637100 TTTAGGGAGGCAGTGTGATGGGG - Intronic
937945565 2:127332884-127332906 CTTTGGGAGGCTGAGGTATGCGG + Intronic
937999765 2:127723515-127723537 CTTTGGGAGGCTGTGGCAGGAGG + Intronic
938901957 2:135805931-135805953 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
939269063 2:139913985-139914007 CTTTGGGAGGCTGAGTTGTGCGG + Intergenic
939317996 2:140577665-140577687 CTTTGGGAGGCTGGGGGGTGGGG - Intronic
939380619 2:141430884-141430906 CTTTGGGAGGCTGAGGGAAGAGG + Intronic
939673952 2:145048398-145048420 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
939799718 2:146694544-146694566 CTTTGGGAGGCTGAGTGAGGAGG - Intergenic
939903621 2:147882305-147882327 CTTTGGGAGGCCCAGTGGGGCGG + Intronic
940061854 2:149580203-149580225 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
940509511 2:154594817-154594839 CTTTGGGAGGCTCAGGCAGGTGG - Intergenic
940910223 2:159203818-159203840 CTTTGGGAGGCTGAGTCAGGAGG - Intronic
940924971 2:159354592-159354614 CTTTGGGAGGCTGAGGCATGCGG - Intronic
941014310 2:160337375-160337397 CTTTGGGAGGCTGAGTGGGGCGG - Intronic
941332482 2:164195667-164195689 CTTTGGGAGGCTGAGTGGGGAGG - Intergenic
941586345 2:167363913-167363935 CTTTGGGAGGCTGAGGGAGGCGG + Intergenic
941791243 2:169554418-169554440 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
941960982 2:171253178-171253200 CTTTGGGAGGCTAAGGTATGTGG - Intergenic
942425025 2:175850427-175850449 CTTTGGGAGGCTGAGGAATGTGG - Intergenic
942435332 2:175966305-175966327 CTTTGGGAGGCTGAGGTATGTGG - Intronic
942569408 2:177298203-177298225 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
942821980 2:180125197-180125219 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
943682199 2:190780386-190780408 CTTTGGGAGGTTCTGAGAGAAGG - Intergenic
943724815 2:191242650-191242672 CTTTGGGAGGCTGTGGCAGGCGG - Intergenic
943881036 2:193143531-193143553 CTTTGGGAGGCTGTGGCAGGAGG + Intergenic
944099357 2:196006068-196006090 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
944115215 2:196178516-196178538 CTTTGGGAGGCTGGGGGAAGGGG - Intergenic
944178028 2:196855351-196855373 CTTTGGGAGGCTGAGATATGAGG - Intronic
944239299 2:197470514-197470536 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
944455789 2:199892775-199892797 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
944499971 2:200349390-200349412 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
944587699 2:201187024-201187046 CTTCGTGAGGTTCTCTGATGTGG - Intronic
944626874 2:201579525-201579547 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
944679902 2:202067730-202067752 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
944717919 2:202393537-202393559 CTTTGGGAGGCTGAGTCAGGAGG - Intronic
944734269 2:202547537-202547559 CTTTGGGAGGCTGGGGCATGTGG + Intronic
944750762 2:202707291-202707313 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
944759882 2:202803769-202803791 CTTTGGGAGGCTCAGGCAGGCGG - Intronic
944890234 2:204109906-204109928 CTTTGGGCTGCTCTGTGACAGGG - Intergenic
944973809 2:205024410-205024432 CTTTGGGAGGCTGGGGCATGTGG - Intronic
945216880 2:207443415-207443437 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
946023635 2:216658793-216658815 CTTTGGGAGGCTGAGGCATGTGG - Intronic
946243277 2:218369869-218369891 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
946252679 2:218423150-218423172 CTTTGGGAGGCTGTGACAGGTGG + Intronic
946766110 2:223042505-223042527 CTTTGGGAGGCTGAGTGGGGTGG - Intergenic
947214778 2:227740100-227740122 CTTTGGGAGGCTGAGGCATGAGG + Intergenic
947237487 2:227957783-227957805 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
947404038 2:229756057-229756079 CTTTGGGAGGCTGTGGCAGGCGG - Intergenic
947521952 2:230853102-230853124 CTTTGGGAGGCTGTGGTAGGAGG - Intergenic
947584020 2:231340957-231340979 CTTTGGGAGGCTGAGGAATGAGG + Intronic
947586076 2:231357812-231357834 CTTTGGGAGGCTCAGGCAGGAGG - Intronic
947599559 2:231437642-231437664 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
947855133 2:233318847-233318869 CTCTGGGCGGCTCTGGGAAGGGG + Intronic
947922387 2:233888599-233888621 CTGTGGGACACTCTGTGAAGGGG + Intergenic
948239143 2:236414567-236414589 CTTTGGGAGGCTTGGTCAGGAGG - Intronic
948261841 2:236610069-236610091 CTTTGGGAGGCTGAGGGAGGCGG - Intergenic
948426412 2:237889867-237889889 CTTTGGGAGGCTCAGGCAGGAGG - Intronic
948640216 2:239370997-239371019 CTGTGGGAAGCCCTGTGGTGTGG - Intronic
948670645 2:239566551-239566573 CTGTGGGAGGGTGTGTGAGGAGG + Intergenic
948991274 2:241555618-241555640 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1168751639 20:286271-286293 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1168785405 20:535110-535132 CTTTGGGAGGCTGAGTTAAGAGG + Intronic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1169010930 20:2249783-2249805 CTTTGGGAGGCTGGGGCATGTGG - Intergenic
1169058048 20:2640237-2640259 CTTTGGGAGGCCGTTTGAGGCGG - Intronic
1169119714 20:3087932-3087954 CTTTGGGAGGCTGAGTGGGGTGG - Intergenic
1169169868 20:3456304-3456326 CTTTGGGAGGCTGAGTCAGGCGG + Intergenic
1169181635 20:3574266-3574288 CTTTGGGAGGCTGAGGTATGGGG + Intronic
1169236922 20:3937078-3937100 CTTTGGGAGGCTGAGTCAGGCGG - Intronic
1169573520 20:6932072-6932094 CTTTGGGAGGCTGAGTGAGGAGG + Intergenic
1169728047 20:8757238-8757260 CTGACGGAGGCGCTGTGATGTGG + Intronic
1170119842 20:12900082-12900104 CTTTGGGAGGCTCAGGCAGGTGG - Intergenic
1170702972 20:18720609-18720631 CTTTGGGAGGCTAAGGCATGTGG + Intronic
1170937850 20:20825259-20825281 CTTGGGGAGGCTCTGGGCTTTGG - Intergenic
1170992456 20:21315739-21315761 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
1171432024 20:25088998-25089020 CCTGGGGAGGCTCTGCGGTGAGG - Intergenic
1171493176 20:25536465-25536487 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
1171903081 20:30874991-30875013 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1172076620 20:32303319-32303341 CTTTGGGAGGCTGAGTGGGGTGG + Intronic
1172131006 20:32655326-32655348 CTTTGGGAGGCTGTGGCAGGAGG + Intergenic
1172157713 20:32840566-32840588 CTTTGGGAGGCTCAGGCAGGGGG - Intronic
1172161869 20:32874465-32874487 CTTTGGGAGGCTGAGGTATGAGG - Intronic
1172171435 20:32936275-32936297 CTTTGGGAGGCTGAGTCAGGCGG - Intronic
1172538352 20:35691805-35691827 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
1172548312 20:35779276-35779298 CTTTGGGAGGCCCTGGCAGGCGG - Intronic
1172550803 20:35798167-35798189 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1172680241 20:36708404-36708426 CTTTGGGAGGCTGAGGGAAGTGG + Intronic
1172690746 20:36787955-36787977 CTTTGGGAGGCTATGGCAGGTGG + Intronic
1172746020 20:37209724-37209746 CTTTGGGAGGCTGAGTCAGGAGG - Intronic
1172832536 20:37848397-37848419 CTTTGGGAGGCTGAGGCATGAGG - Intronic
1172914938 20:38436365-38436387 CACTGGGAGTCTCTGTGATGGGG + Intergenic
1173123233 20:40313194-40313216 TTATAAGAGGCTCTGTGATGTGG - Intergenic
1173255376 20:41390934-41390956 CTTTGGGAGGCTCAGGCAGGAGG - Intergenic
1173370955 20:42434716-42434738 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1173555655 20:43963592-43963614 CTTTCCGGGCCTCTGTGATGGGG + Intronic
1173977640 20:47199139-47199161 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1174005147 20:47404562-47404584 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1174024591 20:47562987-47563009 CTTTGGGAGGCCCAGTGGAGAGG - Intronic
1174128533 20:48326226-48326248 GTTTGGGATGGTTTGTGATGGGG - Intergenic
1174236316 20:49095556-49095578 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1174292037 20:49516122-49516144 CTTTGGGAGGCTGTGGCAGGAGG - Intronic
1174350302 20:49962645-49962667 CTTTGGGAGGCTGAGACATGAGG - Intergenic
1174356488 20:50001676-50001698 CTTTGGGAGGCTCAGGCAGGAGG + Intergenic
1174411516 20:50339647-50339669 CTTTGGGAGCCACAGGGATGTGG + Intergenic
1174482090 20:50838464-50838486 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
1174892083 20:54406270-54406292 CTTTAGGAGGCTGTGTGGGGAGG + Intergenic
1175273675 20:57752887-57752909 CTTTGGGAGACACTCTGATGCGG - Intergenic
1175360783 20:58410666-58410688 CTTTGGGAGGCTGAGTGGGGCGG - Intronic
1176045780 20:63091961-63091983 CTGTGGGGTGCTCTGTGAGGAGG - Intergenic
1176413053 21:6459131-6459153 CCTTGGGGGTCTCTGTGAAGGGG + Intergenic
1176511159 21:7749359-7749381 CTTTGGGAGGCTCAGGCAGGAGG - Intronic
1176656535 21:9592818-9592840 CTGTGGGAACCACTGTGATGGGG + Intergenic
1176802738 21:13447958-13447980 CTTTGGCAGGCTGTGGCATGTGG - Intergenic
1176806268 21:13487095-13487117 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1177005283 21:15664785-15664807 CTTTGGGAGGCTGAGGGAGGAGG + Intergenic
1177032335 21:15996912-15996934 CTTTGGGAGGCTCAGGGAGGCGG + Intergenic
1177624713 21:23645634-23645656 CTTTGGGAGGCTGTGGCAAGTGG - Intergenic
1177801880 21:25835892-25835914 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1178078458 21:29035624-29035646 CTTTGGGAGGCTGAGGCATGCGG - Intronic
1178559526 21:33625725-33625747 CTTTGGGAGGCTGAGGCATGAGG - Intronic
1178645273 21:34379888-34379910 CTTTGGGAGGCTCAGGCAGGAGG - Intronic
1178822346 21:35986900-35986922 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
1178867412 21:36340878-36340900 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1178880357 21:36445072-36445094 CTTTGGGAGGCTGAGTCAGGAGG - Intergenic
1179066378 21:38028502-38028524 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
1179125721 21:38588972-38588994 CTTTGGGAGGCTGAGAGAGGAGG - Intronic
1179127362 21:38602199-38602221 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1179688548 21:43067453-43067475 CCTTGGGGGTCTCTGTGAAGGGG + Intronic
1180208304 21:46276992-46277014 CTTTGGGAGGCTGAGGCATGAGG - Intronic
1180436783 22:15312903-15312925 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1180738853 22:18039127-18039149 CTTTGGGAGGCTGAGTCAGGCGG - Intergenic
1180894905 22:19323486-19323508 CTTTGGGAGGCTGTGGCAGGAGG + Intergenic
1180895107 22:19325537-19325559 CTTTGGGAGGCTGTGGCAGGTGG - Intergenic
1180946823 22:19699473-19699495 CTTTGGGAGGCTCAGGCAGGAGG - Intergenic
1181061836 22:20285471-20285493 GTTTGGGGGTCTCTGTGTTGGGG + Intergenic
1181519442 22:23436816-23436838 TTTTTGGAGGCTTTGTGAAGAGG + Intergenic
1181754326 22:25012514-25012536 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
1181798223 22:25325973-25325995 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
1181840627 22:25656568-25656590 CTTTGGGAGGCTATGGGGGGAGG - Intronic
1181929677 22:26390415-26390437 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1182144340 22:27987967-27987989 CTTTGGGAGGCTGTGTGGGAGGG + Intronic
1182274490 22:29177757-29177779 CTTTGGGAGGCTCAGGCAGGCGG - Intergenic
1182467029 22:30523599-30523621 CTTTGGGAGGCTGAGGCATGTGG - Exonic
1182502040 22:30754858-30754880 CAATGGGAGGCTTTGAGATGGGG - Intronic
1182540443 22:31037670-31037692 CTTTGGGAGGCTCAGACAGGAGG + Intergenic
1182670657 22:31992909-31992931 CTTTGGGAGGCTGACTGAGGGGG + Intergenic
1182679973 22:32071206-32071228 CTTTGGGAGGCTGAGGCATGAGG + Intronic
1182754527 22:32668032-32668054 CTTTGGGAGGCTGAGTCAGGCGG - Intronic
1182958340 22:34448307-34448329 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1183000030 22:34849094-34849116 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1183274259 22:36882534-36882556 CTTTGGGAGGCTGGGGCATGTGG - Intergenic
1183536857 22:38407212-38407234 CTTTGGGAGGCTGAGGCATGCGG - Intergenic
1183721103 22:39561917-39561939 CTTGGGGAGACCATGTGATGTGG + Intergenic
1183877342 22:40794994-40795016 CTTTGGGAGGCTGAGGCATGAGG - Intronic
1183891677 22:40934988-40935010 CTTTGGGAGGCTGGGTCAGGCGG + Intergenic
1183900681 22:41003617-41003639 CTTTGGGAGGCTGAGTGGAGAGG + Intergenic
1183907539 22:41053412-41053434 CTTTGGGAGGCTCAGGCAGGTGG - Intergenic
1183968676 22:41459415-41459437 CTTTGGGAGGCTCAGGCAGGCGG - Intergenic
1183990234 22:41593072-41593094 CTTTGGGAGGCTGAGTCGTGAGG - Intergenic
1183998683 22:41655983-41656005 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1184174816 22:42782432-42782454 CTTTGGGAGGCTGAGTTAGGTGG - Intergenic
1184295074 22:43517999-43518021 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1184329319 22:43816460-43816482 CTTTGGGAGGCTGTGGCAGGAGG + Intergenic
1184352069 22:43951071-43951093 CTTTGGGAGGCTGAGGGAGGCGG + Intronic
1184373237 22:44095978-44096000 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1184527593 22:45034742-45034764 CTTTGGGAGGCTGAGTCAGGAGG - Intergenic
1184559166 22:45251633-45251655 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1184713457 22:46267081-46267103 CTTTGGGAGGCTGAGTCAGGTGG - Intergenic
1184718977 22:46298248-46298270 CTTTGTGAGGCTGGGTGAGGTGG - Intronic
1185133587 22:49055699-49055721 CTACAGGAGCCTCTGTGATGAGG + Intergenic
1185353716 22:50352821-50352843 CTTTGGGAGGCTGAGTGGGGAGG + Intronic
949358711 3:3208968-3208990 GTTAGGGAGGCTGTGTGTTGGGG + Intergenic
950835490 3:15914936-15914958 CTTTGGGAGGCTGTGGCAGGTGG + Intergenic
950946023 3:16947191-16947213 CTTTGGGAGGCTGTGGTAGGAGG - Intronic
951065697 3:18262730-18262752 CTTTGGGAGGCTGAGTCACGTGG + Intronic
951523666 3:23632455-23632477 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
951691882 3:25405273-25405295 CTTTGGGAGGCTGTGGAAGGAGG + Intronic
951735821 3:25862639-25862661 CTTTGGGAGGCTGAGGCATGCGG - Intronic
951773342 3:26282754-26282776 CTTTGGGAGGCTAAGGCATGTGG + Intergenic
951838803 3:27011436-27011458 CTTTGGGAGGCTGAGGCATGCGG - Intergenic
951882426 3:27492313-27492335 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
951916252 3:27803849-27803871 CTTTGGGAGGCCAAGGGATGCGG - Intergenic
952102063 3:30025765-30025787 CTTTGGGAGGCTGAGTCACGCGG - Intergenic
952182564 3:30933634-30933656 CTTTGGGAGGCTGAGTACTGGGG - Intergenic
952305781 3:32144945-32144967 CTTTGGGAGGCTCAGGTAAGTGG - Intronic
952427496 3:33190745-33190767 CTTTTGGAGGATCTGTCATCAGG - Intronic
952617056 3:35286350-35286372 CTTTGGGAGGCTGTGGTAGGTGG - Intergenic
952703978 3:36358116-36358138 CTTTGGGAGGCTGAGGGAGGAGG - Intergenic
952707561 3:36394651-36394673 CTTTGGGAGGCTGAGGCATGTGG + Intronic
952740169 3:36727037-36727059 CTTTGGGAGGCTTAGGCATGTGG + Intronic
952825361 3:37520286-37520308 CTTTGGGAGGCGCTGCGAAGAGG + Intronic
952944256 3:38466744-38466766 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
952952808 3:38538476-38538498 CTTTGGGAGGCTCTGTGATGGGG + Intronic
953132408 3:40152871-40152893 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
953324974 3:42005332-42005354 CTTTGGGAGGCTGTGGCAGGTGG - Intergenic
953343827 3:42158698-42158720 CTTTGGGAGGCTGAGGCATGCGG + Intronic
954087503 3:48256764-48256786 CCTTGGGAGTCGCTGTGATACGG + Intronic
954180407 3:48877169-48877191 CTTTGGGAGGCTGAGTCAGGCGG + Intronic
954207718 3:49072796-49072818 CTTTGGGAGGCTGAGCCATGAGG + Intronic
954246677 3:49337802-49337824 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
954319828 3:49824471-49824493 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
954350229 3:50037154-50037176 CTTTGGGAGGCTGTGGCAGGAGG + Intronic
954518192 3:51198784-51198806 CTTTGGGAGGCTGAGTCAGGCGG + Intronic
954600730 3:51865833-51865855 CTTTGGGAGGCTGTGGCAGGAGG - Intergenic
954718783 3:52542099-52542121 CTTTGGGAGGCTCAGGCAGGAGG + Intronic
954805310 3:53216307-53216329 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
954889996 3:53917694-53917716 CTTTGGGAGGCTGAGTTAGGCGG - Intergenic
955055174 3:55448188-55448210 CTTTGGGAGGCTGAGTTGTGGGG + Intergenic
955217140 3:56993616-56993638 CTTTGGGAGGCTGTGACAGGAGG - Intronic
955226430 3:57064021-57064043 CTTTGGGAGGCCCAGGGAGGGGG + Intronic
955259208 3:57367672-57367694 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
955360811 3:58273314-58273336 CTTTGGGAGGCTAAGAGAGGAGG + Intronic
955681731 3:61508493-61508515 CTTTGGGAGGCTTAGATATGAGG - Intergenic
955906164 3:63809902-63809924 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
955981921 3:64535784-64535806 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
956069392 3:65431741-65431763 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
956151230 3:66245149-66245171 CTTTGGGAGGCTGAGTCAGGAGG - Intronic
956401483 3:68884349-68884371 CTTTGGCAGGATCTGTGGGGTGG + Intronic
956433512 3:69210768-69210790 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
956481975 3:69682104-69682126 CTTTGGGAGGCTGAGTAAGGTGG + Intergenic
956531641 3:70226492-70226514 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
956576100 3:70754332-70754354 CTTTGGGAGGCTGTGGCAGGGGG + Intergenic
957325514 3:78687872-78687894 CTTTGGGAGGCTCAGGCAGGAGG - Intronic
957541593 3:81577183-81577205 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
957626285 3:82656644-82656666 CTTTGGAAGGCTCCATGTTGTGG - Intergenic
957728957 3:84107091-84107113 CTTTGGGAGGCCCTGTCTTGTGG + Intergenic
957850994 3:85807253-85807275 CTTTGGGAGGCTGTGGCAGGCGG + Intronic
958035899 3:88170400-88170422 CTTTGGGAGGCTGGGGGGTGGGG + Intergenic
958057425 3:88430002-88430024 CTTTGGGAGGCTGAGGGAGGAGG - Intergenic
958172387 3:89954343-89954365 CTTTGGGAGGCTGAGTTAGGTGG + Intergenic
958268083 3:91463554-91463576 TTTTGGAAGGCACTGTGGTGTGG - Intergenic
958926801 3:100166989-100167011 CTTTGGGAGGCTGAGTGGGGAGG - Intronic
959103278 3:102038390-102038412 CTTTGGGAGGCTGAGGGCTGAGG - Intergenic
959458027 3:106588504-106588526 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
959505534 3:107152577-107152599 CTGTGGGGGGCTCTGAGATTGGG - Intergenic
959511170 3:107214110-107214132 CTTTGGGAGGCTGAGTCAGGTGG - Intergenic
959690172 3:109189865-109189887 GTTTGGGAGACTCTGTGTTCTGG + Intergenic
959851513 3:111093677-111093699 CTTTGGGAGGCTCAGGCAGGCGG - Intronic
959898642 3:111634651-111634673 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
960082845 3:113559686-113559708 CTTTGGGAGGCTGAGTTGTGTGG - Intronic
960275633 3:115726392-115726414 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
960509524 3:118531649-118531671 CTTGGGGTGGCTCTGAGATGGGG - Intergenic
960806386 3:121587429-121587451 CTTTGGGAGGCTGTGGCAGGTGG - Intergenic
961163083 3:124745950-124745972 CTCTGGGTAGCTCTGGGATGGGG + Intergenic
961191059 3:124962048-124962070 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
961279161 3:125752016-125752038 CTTTGGGAGGCTGTGCCAGGCGG + Intergenic
961538763 3:127586600-127586622 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
961682626 3:128609034-128609056 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
961689810 3:128661000-128661022 CTTTGGGAGGCTGAGGCATGTGG - Intronic
961700099 3:128737280-128737302 CTTTGGGAGGCTGAGGGAGGCGG - Intronic
961701135 3:128745607-128745629 CTTTGGGAGGCTGAGGCATGTGG - Intronic
962184255 3:133241855-133241877 CTTTGGGAGGCTGTGGCAGGTGG - Intronic
962230910 3:133664561-133664583 CTTTGGGAGGCTGAGTCAGGTGG - Intergenic
962588908 3:136868992-136869014 CTTTGGGAGGCTGAGGCATGCGG + Intronic
962816228 3:139003597-139003619 CTTTTGGAGGCTGTGTCAGGAGG + Intergenic
963104962 3:141639131-141639153 CTTTGGGAGGCTGAGTGGGGGGG + Intergenic
963157800 3:142117851-142117873 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
963174174 3:142281141-142281163 CTTTGGGAGGCTGAGTCATGTGG - Intergenic
963665833 3:148184827-148184849 CTTTGGGAGGCTGAGTCAGGTGG - Intergenic
963907796 3:150787511-150787533 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
963993224 3:151677585-151677607 CTTTGGGAGGCTGAGTCAAGTGG - Intergenic
964103961 3:153019806-153019828 CTTTGGGAGGCTAAGGGAGGAGG + Intergenic
964327916 3:155567314-155567336 CTTTGGGAGGCTGAGGGAGGGGG - Intronic
964362790 3:155915777-155915799 CTTTGGGAGGCTGAGTGGGGTGG - Intronic
964573548 3:158139155-158139177 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
964576233 3:158171704-158171726 CTTTGGGAGGCTCAGGCAGGAGG + Intronic
964609108 3:158591401-158591423 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
965208094 3:165748101-165748123 ATTTGGAAGGCTCTGAGATAAGG + Intergenic
965297895 3:166972974-166972996 TTTTGGGAGGTCCTGTCATGAGG - Intergenic
965578145 3:170238975-170238997 CTTTGGGAGGCTAGGTCAGGAGG - Intronic
965592836 3:170378784-170378806 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
965619776 3:170631334-170631356 CTTTGGGAGGCTAAGATATGAGG + Intronic
965643548 3:170856549-170856571 CTTTGGGAGGCTCAGGCAGGAGG + Intronic
965784983 3:172326067-172326089 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
965944071 3:174218609-174218631 CTTTGGGACTCTCTTAGATGAGG + Intronic
966158546 3:176944819-176944841 CTTTGGGAGGCTTAGTGGGGAGG + Intergenic
966388298 3:179425278-179425300 CGTGGGGAGGCTCTGAGAGGAGG - Intronic
966418517 3:179714642-179714664 ATTTGGGAGGCTGTGTTTTGAGG + Intronic
966448340 3:180029270-180029292 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
966730742 3:183149296-183149318 CTTTGGGAGGCTCAGGGGGGCGG + Intronic
966973452 3:185065803-185065825 CTTTGGGAGGCTGTGGCAGGCGG + Intergenic
967188756 3:186967433-186967455 CTTTGGGAGACTGAGTCATGTGG - Intronic
967367346 3:188702197-188702219 CTTTGGGAGGCTGAGGGAGGCGG - Intronic
967515580 3:190364863-190364885 TTTTGAGGGGCTCTGTGACGTGG - Intronic
967926204 3:194650160-194650182 CTTTGGGAGGCTGTGGCAGGCGG - Intronic
968110432 3:196041940-196041962 CTTTGGGAGGCTGAGGCATGTGG - Intronic
968118691 3:196109253-196109275 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
968369839 3:198217007-198217029 CTTTGGGAGGCTAAGAGAGGAGG + Intergenic
968462528 4:732477-732499 CTTTGGAAGTCTCTGTGACCAGG + Intronic
968840717 4:3003432-3003454 CTTTGGGAGGCAGAGTTATGTGG - Intronic
969074588 4:4567989-4568011 CTTTGGGAGGCTGAGTGGGGTGG - Intergenic
969168742 4:5341484-5341506 CTTTGGGAAAGTATGTGATGAGG - Intronic
969213367 4:5704951-5704973 CTTTGGGAGGCTAAGTCAGGAGG - Intronic
969230998 4:5831188-5831210 CTTTGGGAGGCTCAGGTAGGGGG - Intronic
969332247 4:6481733-6481755 CTTTGGGAGGCTGAGGCATGTGG + Intronic
969601459 4:8179002-8179024 CTTTGGGAGGCTGAGGGAAGAGG - Intergenic
969807318 4:9619359-9619381 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
969877608 4:10147475-10147497 CTTTGGGAAGCTCCATAATGAGG - Intergenic
969909518 4:10430665-10430687 CTTTGGGAGGCTGAGTCAGGCGG - Intergenic
969993585 4:11289530-11289552 CTTTGGGAGGCTAAGTAAGGAGG + Intergenic
970368102 4:15381172-15381194 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
970725576 4:19040409-19040431 CTTTGGGAGGCTATGGCAGGTGG + Intergenic
971275938 4:25196953-25196975 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
971318918 4:25589568-25589590 CTTTGGGAGGCTGAGGCATGAGG - Intergenic
971437105 4:26639301-26639323 CTTTGGGAGGCTCTGGTGGGAGG - Intronic
971867468 4:32190904-32190926 CTTTGGGAGGCTGAGTGGGGTGG + Intergenic
972564900 4:40260831-40260853 CTTTGGGAGGCTCAGGCAGGGGG - Intergenic
972567000 4:40278608-40278630 CTTTGAGAGGCTGAGTTATGAGG - Intergenic
972627673 4:40817162-40817184 CTTTGGGAGGCTGAGGGAGGCGG + Intronic
972737328 4:41855690-41855712 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
973004053 4:44987890-44987912 CTTTGGGAGGCTGTGGCAGGTGG - Intergenic
973054726 4:45641529-45641551 CTTTGGGAGGCTGTGACAGGTGG + Intergenic
973620151 4:52718119-52718141 CTTTGGGAGGCTGAGGCATGGGG + Intergenic
973964940 4:56152388-56152410 CTTTGGGAGGCTGAGTCATGAGG + Intergenic
974028462 4:56754955-56754977 CTTTGGGAGGCTGAGTGGGGAGG - Intergenic
974033040 4:56793382-56793404 TTTTGGGAGGCTGTGTGGGGAGG - Intergenic
974084297 4:57242976-57242998 CTTTGGGAGGCTGTGGCAGGTGG - Intergenic
974609315 4:64195061-64195083 CTTTGGGAGGCTGTGGCAGGTGG - Intergenic
974718298 4:65700503-65700525 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
974760199 4:66265255-66265277 CTTTGGGAGGCTGAGTCAGGTGG - Intergenic
974931728 4:68367686-68367708 CTTTGGGAGGCTCAGTGGGGTGG + Intergenic
974957888 4:68665801-68665823 CTTTGGGAGGCTGAGGCATGTGG + Intronic
975529647 4:75386866-75386888 CTTTGGGAGGCTGGGGCATGTGG - Intergenic
975781950 4:77849157-77849179 CTTTGGGAGGCTGGGGGCTGGGG - Intergenic
975786799 4:77898735-77898757 CTTTGGGAAGCTGAGGGATGTGG - Intronic
975964297 4:79951334-79951356 CTTTGGGAGGCTGAGGGAAGGGG + Intronic
976022864 4:80651606-80651628 CTTTGGGAGGCTCAGATAGGAGG - Intronic
976108457 4:81644559-81644581 AATTGGGAGACTCTGTGGTGGGG - Intronic
976256612 4:83106954-83106976 CTTTGGGAGGCTCAGGCAGGCGG + Intronic
976292803 4:83438495-83438517 CTTTGGGAGGCTATGGGGGGCGG + Intronic
976484988 4:85591287-85591309 CTTTGGGAGGCTGAGTTGTGTGG - Intronic
976496017 4:85730650-85730672 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
976658960 4:87519313-87519335 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
976896828 4:90122898-90122920 CTTTGGGAGGCTGAGTGTGGAGG + Intergenic
976964155 4:91013862-91013884 CTTTGGGAGGCTAAGAGAGGCGG - Intronic
977311370 4:95391831-95391853 CTTTGGGAGGCTGAGAGAGGTGG + Intronic
977389243 4:96386663-96386685 CTTTGAGAAGCACTGTCATGAGG - Intergenic
977554448 4:98474589-98474611 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
977871202 4:102092770-102092792 ATTTGGGAGGATGTGTGTTGGGG - Intergenic
978334894 4:107656357-107656379 CTTTGGGAGGCTGAGGGAAGTGG - Intronic
978478908 4:109165470-109165492 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
978564213 4:110064729-110064751 CTTTGGGAGGCTGTGGCAGGAGG - Intronic
979240762 4:118445007-118445029 CTTTGGGAGGCTCAGTCAGGCGG - Intergenic
979258550 4:118628974-118628996 CTTTGGGAGGCTAAGAGAGGAGG + Intergenic
979329804 4:119411581-119411603 CTTTGGGAGGCTAAGAGAGGAGG - Intergenic
979537431 4:121839321-121839343 CTTTGGGAGGCTGAGGCATGTGG + Intronic
979584176 4:122395292-122395314 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
980203438 4:129685805-129685827 CTTTGGGAGGCTCAGATAGGAGG + Intergenic
980816366 4:137951699-137951721 CTTTGGGAGGCTAAGTCAGGTGG + Intergenic
981002708 4:139843022-139843044 CTTTGGGAGGCTGTGGTAGGCGG - Intronic
981184545 4:141785516-141785538 CTTTGGGAGGCTATGACAGGTGG + Intergenic
981295943 4:143131540-143131562 CTTTGGGAGGCTGAGTGGGGTGG + Intergenic
981323737 4:143423452-143423474 CTTTGGGAGGCTGAGGCATGTGG + Intronic
981388490 4:144159311-144159333 CTTTGGGAGGCTGAGGCATGCGG - Intergenic
981486554 4:145292777-145292799 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
981863366 4:149383708-149383730 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
982164265 4:152600827-152600849 CTTTGGGAGGCTAAGTCAGGTGG + Intergenic
982268025 4:153558012-153558034 CTTTGGGAGGCCCAGGGAGGTGG - Intronic
982359879 4:154508115-154508137 CTTTGGGAGGCTCAGTCAGGAGG + Intergenic
982449693 4:155539211-155539233 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
982713220 4:158779825-158779847 CTTTGGGAGGCTCAGGGTGGGGG - Intronic
982737171 4:159018845-159018867 CTTTGGGAGGCTGTGGCAGGCGG + Intronic
982755150 4:159209133-159209155 CTTTGGGAGGCTCAGGCAGGCGG - Intronic
982957080 4:161784177-161784199 CTTTGGGAGGCTGAGTGGGGAGG - Intronic
983979210 4:173973508-173973530 CTCTGGGAAGCTCTGTGAGCTGG + Intergenic
984016968 4:174438322-174438344 CTTTGGGAGGCTGAGAGAGGAGG + Intergenic
984630682 4:182057517-182057539 CTTTGGGAGGCTCAGGCAGGAGG - Intergenic
984743435 4:183189189-183189211 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
984743484 4:183189742-183189764 ATTTGGGAGGCTCTGAATTGTGG + Intronic
984754442 4:183312829-183312851 CCTTGTCAGGCTCTGAGATGTGG + Intronic
985237697 4:187894182-187894204 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
985270476 4:188190008-188190030 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
985841984 5:2313434-2313456 TCTTGGGAGGCTCACTGATGTGG + Intergenic
985942351 5:3147688-3147710 CTTTGGGAGGCTGAGGTATGTGG - Intergenic
986117942 5:4798686-4798708 CTTTGGGAGGCTAAGGGAGGAGG - Intergenic
986160560 5:5224530-5224552 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
986222560 5:5782069-5782091 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
986697436 5:10370344-10370366 CTTTGGGAGGCTCAGGCAAGAGG - Intronic
986741562 5:10710022-10710044 GATTGCCAGGCTCTGTGATGAGG + Intronic
986808262 5:11329396-11329418 CTTTGGGAGGCCGAGGGATGGGG - Intronic
987253168 5:16120985-16121007 CTTTGGGATGCTTTGTTATGTGG + Intronic
987285270 5:16449774-16449796 CTTTGGGAGGCTGAGGCATGAGG + Intergenic
987311427 5:16684801-16684823 CTTTGGGAGGCTGAGGCATGTGG + Intronic
987389941 5:17366413-17366435 CTTTGGGAGGCTTAGTGGGGTGG + Intergenic
987785400 5:22492588-22492610 CTTTGGGAGGCTGAGGCATGTGG - Intronic
987811093 5:22837173-22837195 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
987967315 5:24893355-24893377 CTTTGTGAAGCTGTGAGATGAGG - Intergenic
988183160 5:27824793-27824815 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
989108818 5:37887867-37887889 GTTTGGGAGGCTGTGTAGTGAGG + Intergenic
989184536 5:38610395-38610417 CTTTGGGAGGCTGAGTGGGGCGG + Intergenic
989258798 5:39396188-39396210 CTTTGGGAGGCTGAGTCAGGCGG - Intronic
989848248 5:46173563-46173585 TTTTGGTAGGATCTGTGAAGGGG - Intergenic
990299974 5:54440425-54440447 CTTTGGGAGGCTGAGGAATGAGG + Intergenic
990315841 5:54582513-54582535 CTTTGGGAGGCTGAGGTATGAGG + Intergenic
990444805 5:55884662-55884684 CTTTGGGAGGCTGAGAGAGGAGG - Intronic
990453325 5:55958592-55958614 CTTTGGGAGGCCGAGGGATGTGG + Intronic
990513135 5:56507347-56507369 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
990520538 5:56575043-56575065 CTTTGGGAGGCTCAGACAGGAGG + Intronic
990594028 5:57295217-57295239 CTTTGGGAGGCTGAGTAAGGAGG + Intergenic
990902627 5:60769804-60769826 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
991212239 5:64118852-64118874 CTTTGGGAGGCTGAGTCAGGTGG - Intergenic
991338720 5:65580755-65580777 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
991569879 5:68042826-68042848 CTTTGGGAGGCTGAGACATGAGG + Intergenic
991583777 5:68182505-68182527 CTTGAGCAGGCTCTGTGCTGTGG + Intergenic
992005657 5:72475060-72475082 CTTTGGGAGCTTCTTTGAGGAGG + Intronic
992055820 5:72988194-72988216 CTTTGGGAGGCTGAGTGGGGCGG + Intronic
992443852 5:76817524-76817546 CTTTGGGAGGCTGAGTGGGGAGG + Intergenic
992718937 5:79540192-79540214 CTTTGGGAGGCTGTGGCAGGTGG + Intergenic
992720747 5:79559108-79559130 CTTTGGGAGGCTGAGACATGTGG + Intergenic
992777501 5:80101469-80101491 CTTTGGGAGGCTGAGTGGGGCGG + Intergenic
992910334 5:81390203-81390225 CTTTGGGAGGCTCAGGTAGGAGG - Intronic
992914167 5:81431827-81431849 CTTTGGGAGGCCAAGTGAGGAGG - Intronic
992968993 5:82036080-82036102 TTTTGGGGGGTTTTGTGATGTGG + Intronic
993237415 5:85330872-85330894 CTTTGGGAGGCTCAGGCAGGAGG - Intergenic
993273150 5:85820720-85820742 CTTTGGGAGGCTCAGGCAGGTGG - Intergenic
994260388 5:97651718-97651740 TTTTAGGAGGCCCTGTGAGGTGG - Intergenic
994599247 5:101881360-101881382 CTTTGGGAGGCTGTGGCAGGTGG + Intergenic
994639564 5:102389985-102390007 CTTGGGGAGGCTGAGTGAGGAGG - Intronic
995131150 5:108631681-108631703 CTTTGGGAGGCTGAGGCATGAGG - Intergenic
995158849 5:108951025-108951047 CTTTGGGAGGCTCGGGCAGGCGG + Intronic
996211208 5:120813181-120813203 CTTTGGGAGGCTGAGGCATGCGG - Intergenic
996379800 5:122851408-122851430 CTTTGGGAGGCTGAGGCATGTGG - Intronic
996661695 5:126011876-126011898 CTTTGGGAGGCTGAGGCATGCGG - Intergenic
996703957 5:126478185-126478207 CTTTGGGAGGCTGAGGGCTGAGG + Intronic
996853955 5:127983711-127983733 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
996886984 5:128368894-128368916 CTTTGGGAGGCTCAGGCAGGAGG - Intronic
996981689 5:129503593-129503615 CTTTGGGAGGCTGAGGCATGCGG + Intronic
997160041 5:131598833-131598855 CTTTGGGAGGCTGTGGGCTTTGG - Intronic
997313110 5:132906854-132906876 CTTTGGGAGGCTAAGCAATGAGG + Intronic
997343174 5:133162631-133162653 CTTTGGGAGGCTGTGGCAGGAGG - Intergenic
997430639 5:133838129-133838151 CTTTGGGAGGCTGAGTGGGGTGG - Intergenic
997474558 5:134135201-134135223 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
997652530 5:135533228-135533250 CTTTGGGAGGCCCAGGTATGTGG - Intergenic
997932028 5:138080707-138080729 CTTTGGGAGGCTGAGTGGGGAGG - Intergenic
998083794 5:139299428-139299450 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
998098517 5:139412502-139412524 CTTTGGGAGGCTGTGGCAGGTGG - Exonic
998114038 5:139523040-139523062 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
998156581 5:139790173-139790195 CTTTGGGAGGCTGTGGCAGGAGG + Intergenic
998472319 5:142392653-142392675 CTTTGGGAGGCTCAGGCAAGTGG + Intergenic
998825220 5:146094552-146094574 CTTTGGGAATGTTTGTGATGTGG - Intronic
998826697 5:146108892-146108914 CTTTGGGAGGCTCAGGCAGGTGG + Intergenic
999151135 5:149426975-149426997 CTTTGGGAGGCTCAGGCAGGAGG - Intergenic
999541720 5:152581935-152581957 CTTTGGGAGGCTGAGTGAGGAGG - Intergenic
999765327 5:154736337-154736359 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
999915754 5:156257618-156257640 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1000009851 5:157220630-157220652 GTTTGGGAGCCTCCATGATGTGG - Intronic
1000094164 5:157956271-157956293 CTTTGGGAGGCTGAGCCATGTGG - Intergenic
1000306639 5:160000778-160000800 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1000755614 5:165155492-165155514 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1000978094 5:167786816-167786838 GTTTGGGGAGCTCTGAGATGTGG - Intronic
1001362938 5:171105452-171105474 CTTTGGGAGGCTGTGGCAGGAGG + Intronic
1001373525 5:171231190-171231212 CTTTGGGAGGCTGAGTGCGGAGG - Intronic
1001380473 5:171303118-171303140 CTTTGGGAGGCTGTGGCAGGTGG - Intergenic
1001478627 5:172070002-172070024 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1001755362 5:174164480-174164502 CTTTGGGAGGCTGAGGTATGTGG - Intronic
1002034579 5:176457432-176457454 CTTTGGGAGGCTGTGGCAGGTGG - Intronic
1002276181 5:178105624-178105646 CTTTGGGAGGCTGAGACATGTGG + Intergenic
1002507585 5:179690646-179690668 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
1002590183 5:180285833-180285855 CTTTGGGAGGCTGTGGCGTGTGG + Intronic
1002609791 5:180408868-180408890 CTTTGGGAGGCTAAGTCAGGAGG + Intergenic
1002729118 5:181322585-181322607 CTTTGGGAGGCTAAGAGAGGAGG + Intergenic
1002741025 5:181435601-181435623 CTTTGGGAGGCTCAGTCAGGCGG - Intergenic
1003059493 6:2851711-2851733 CTTTGGGAGGCTCAGGCAGGCGG - Intergenic
1003210900 6:4065723-4065745 CTTTGGGAGGCTCAGGCGTGTGG - Intronic
1003284376 6:4722094-4722116 CTTTGGGAGGCTGAGGCATGCGG - Intronic
1003541627 6:7023614-7023636 CTTTGGGAGGCTGAGTCAGGAGG - Intergenic
1003635687 6:7829458-7829480 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1003734064 6:8857766-8857788 CTTTGGGAGGCTGGGGGAGGGGG + Intergenic
1003914849 6:10777161-10777183 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
1004134466 6:12953077-12953099 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1004152758 6:13135773-13135795 CTTTGGGAGGCTGAGGGAAGGGG + Intronic
1004530817 6:16453895-16453917 CTTTGGGAGGCTGAGTCAGGCGG + Intronic
1005326479 6:24706666-24706688 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1005400714 6:25430672-25430694 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
1005414929 6:25589729-25589751 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1005440756 6:25865273-25865295 GTTTATGTGGCTCTGTGATGTGG + Intronic
1005831259 6:29672874-29672896 AGTTGGGCGGCTCTGTGAGGTGG + Exonic
1006548553 6:34800970-34800992 CTTTGGGAGGCTCAGGTAGGTGG - Intronic
1006571966 6:35013032-35013054 CTTTGGGAGGCTGAGAGAGGAGG - Intronic
1006590619 6:35153093-35153115 CTTTGGGAGGCTCAGACAGGAGG + Intergenic
1006650716 6:35549041-35549063 CTTTGGGAGTCTGAGTGAGGAGG - Intergenic
1006690797 6:35883173-35883195 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1006811758 6:36824701-36824723 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1006965288 6:37977544-37977566 CTTTGGGAGGCTGAGGCATGCGG - Intronic
1006986905 6:38181742-38181764 CTTTGGGAGGCTGAGAGAGGCGG + Intronic
1007036051 6:38674751-38674773 CTTTGGGAGGTAATGTCATGAGG + Intergenic
1007325497 6:41056362-41056384 CTTTGGGAGGCTGAGGCATGAGG - Intronic
1007449014 6:41929143-41929165 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
1007485867 6:42180227-42180249 ATGTGGGGGGCTGTGTGATGTGG + Intergenic
1007493913 6:42245862-42245884 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
1007523981 6:42474902-42474924 CTGTGCTAGGGTCTGTGATGAGG - Intergenic
1007535742 6:42587061-42587083 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
1007557609 6:42780146-42780168 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1007574978 6:42919468-42919490 CTTTGGGAGGCCCAGGCATGAGG + Intronic
1007601630 6:43085688-43085710 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1007687984 6:43678595-43678617 CCTTGGGAGTCGCTGTGATACGG + Exonic
1007759323 6:44123760-44123782 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
1007770465 6:44187797-44187819 CTTTGGGAGGCTCGGGGGGGTGG - Intergenic
1008124450 6:47653114-47653136 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1008614048 6:53209108-53209130 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1008987120 6:57558010-57558032 TTTTGGAAGGCACTGTGGTGTGG + Intronic
1009175078 6:60450578-60450600 TTTTGGAAGGCACTGTGGTGTGG + Intergenic
1009382182 6:63045433-63045455 CTTTGTGTTGCTCTTTGATGTGG - Intergenic
1009421676 6:63471219-63471241 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1009744141 6:67791364-67791386 CTTTGGGAGGCTGTGGCAGGTGG + Intergenic
1009985280 6:70774784-70774806 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
1009999382 6:70933040-70933062 CTTTGGGAGGCTCAGGCAGGAGG - Intronic
1010610102 6:77944064-77944086 CTTTGGGAGGCTGAGGGAGGCGG + Intergenic
1010624968 6:78127587-78127609 CTTTGGGAGGCTGAGTGGGGCGG + Intergenic
1010862267 6:80927306-80927328 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1011162074 6:84402737-84402759 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
1011263093 6:85488822-85488844 CTTTGGGAGGCTGTGGCAGGTGG - Intronic
1011583183 6:88894821-88894843 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1011618064 6:89216191-89216213 GTTTGGGAGCCCATGTGATGAGG + Intronic
1011805533 6:91068905-91068927 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1012168496 6:95989331-95989353 CTTTGGGAGGCTGAGGGAGGAGG - Intergenic
1012337273 6:98076752-98076774 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1012609144 6:101194119-101194141 CTTTGGGAGGCTGAGGCATGCGG + Intergenic
1012657379 6:101841605-101841627 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
1012938304 6:105391125-105391147 CTTTGGGAGGCTGAGGGCTGAGG + Intronic
1013060850 6:106632457-106632479 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1013509746 6:110833768-110833790 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
1013712860 6:112921630-112921652 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1013972601 6:116039368-116039390 TTTATGGAGGCTCTGTGATGGGG + Intronic
1014021757 6:116598972-116598994 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1014066589 6:117134218-117134240 CTTTGGGAGGCTAAGAGAGGTGG + Intergenic
1014068358 6:117152610-117152632 CTTTGGAAGGCTCTGCCAGGAGG + Intergenic
1014156257 6:118113328-118113350 CTTTGGGAGGCTGGGTCAAGAGG - Intronic
1014249808 6:119103682-119103704 CTTTGGGAGGCTGTGACAGGCGG + Intronic
1014261416 6:119222568-119222590 CTTTGGGAGGCTTTGGCAGGAGG - Intronic
1014634005 6:123822503-123822525 CTTAGGGAGGTTCACTGATGTGG + Intronic
1014924377 6:127253706-127253728 CTTTGGGAGGCTGAGTGGGGTGG + Intergenic
1014924471 6:127254744-127254766 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
1015514117 6:134067946-134067968 CTTTGGGAGGCTGAGTGGGGCGG - Intergenic
1016019872 6:139226053-139226075 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1016407055 6:143741856-143741878 CTTTGGGAGGCTCAGGCAGGCGG + Intronic
1016467936 6:144345429-144345451 CTTTGGGAGGCTGCGGCATGAGG + Intronic
1016910401 6:149193016-149193038 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1016968323 6:149739528-149739550 CTTTGGGAGGCTGAGTGAGGCGG - Intronic
1016970220 6:149755160-149755182 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1017035069 6:150259718-150259740 CTTTGGGAGGCTGAGTTAGGTGG + Intergenic
1017095560 6:150801681-150801703 CTTTGGGAGGCTCAGGCAGGAGG - Intronic
1017245795 6:152223376-152223398 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1017731450 6:157320712-157320734 CTTTGGGAGGCTGAGGGAGGCGG - Intronic
1017859883 6:158386086-158386108 CTTTGGGAGGCTGAGGTATGAGG - Intronic
1018023391 6:159784545-159784567 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
1018420449 6:163636179-163636201 CTCTGGGAGGCTCTGGGCTGGGG + Intergenic
1018610054 6:165639492-165639514 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1018835274 6:167478630-167478652 CTTTGGGATGCTGTGTCAGGAGG - Intergenic
1019121024 6:169803580-169803602 GTTTGGAAAGCTCTGTGGTGAGG - Intergenic
1019224346 6:170498057-170498079 CTCTGGGAGACTCTGGGAGGAGG - Intergenic
1019246130 6:170711196-170711218 CTTTGGGAGGCTCAGTCAGGCGG - Intergenic
1019391805 7:792102-792124 CTTTGGGAGGCTGAGTTAGGAGG - Intergenic
1019450208 7:1093813-1093835 CTTCCGGAGGCTCTGTCTTGGGG + Exonic
1019457860 7:1140167-1140189 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1019467047 7:1195668-1195690 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1019566314 7:1680983-1681005 CTTTGGGAGGCTGAGGGGTGTGG - Intergenic
1019963531 7:4481021-4481043 CTTTCAGAGGCTATGGGATGGGG - Intergenic
1019987790 7:4670442-4670464 CTTTGGGAGGCTGTGGCAGGGGG - Intergenic
1019996611 7:4728645-4728667 CTTTGGGAGGCTGTGGCAGGAGG + Intronic
1020138870 7:5601592-5601614 CTTTGGGAGGCTGAGTTAGGAGG + Intronic
1020157928 7:5742288-5742310 CTTTGGGAGGCTGAGGGAGGCGG - Intronic
1020402906 7:7797928-7797950 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
1020416628 7:7953472-7953494 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1020586381 7:10074862-10074884 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1020695597 7:11409983-11410005 CTTTGGGAGGCTCAGTCGGGCGG - Intronic
1020843982 7:13259357-13259379 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1020868969 7:13604048-13604070 CTTTGGGAGGCTAAGGGAGGGGG + Intergenic
1021195723 7:17672378-17672400 CTTTGGGAAGCTCAGTGCTTTGG + Intergenic
1021221014 7:17975471-17975493 CTTTGGGAGGCTGAGTCAGGAGG - Intergenic
1021320744 7:19207817-19207839 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1021397860 7:20172714-20172736 CTTTGGGCGGTTAAGTGATGGGG - Intronic
1021445959 7:20733881-20733903 CTTTGGGAGGCTAAGGGAGGTGG - Intronic
1021449425 7:20769124-20769146 CTTTGGGAGGCCCAGTCAGGAGG - Intronic
1021696279 7:23279238-23279260 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1022137669 7:27464865-27464887 CTTTGGGAGGCTGAGGCATGAGG + Intergenic
1023134952 7:37042039-37042061 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1023139452 7:37086497-37086519 CTTTGGGAGGCTGAGTCAGGCGG + Intronic
1023444143 7:40214670-40214692 CTTTGGGAGGCTTGGGGGTGGGG + Intronic
1023483833 7:40663563-40663585 CTTGGAGATCCTCTGTGATGGGG + Intronic
1023484131 7:40666115-40666137 CTTTGGGAGGCTGAATCATGGGG + Intronic
1023796489 7:43797329-43797351 CTTTGGGAGGCTCAGGCAGGCGG - Intronic
1023827875 7:44021633-44021655 CTTTGGGAGGCTGAGTGCAGTGG - Intergenic
1023858823 7:44204108-44204130 CATTGCGAGGGTCTGTCATGTGG + Intronic
1023917700 7:44602682-44602704 CTTTGGGAGGCTGAGTCAGGAGG - Intergenic
1024298724 7:47868122-47868144 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1024304305 7:47914441-47914463 TTGTGAGAGGCTGTGTGATGAGG + Intronic
1024422242 7:49182313-49182335 CTTTGGGAGGCTGTGGCAGGTGG + Intergenic
1025053961 7:55749507-55749529 CTTTGGGAGGCTAAGAGAGGAGG - Intergenic
1025143821 7:56487284-56487306 CTTTGGGAGGCTGAGTGGGGAGG + Intergenic
1025168366 7:56733800-56733822 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1025640581 7:63363930-63363952 CTTTGGGAGGCTATGGCAGGAGG - Intergenic
1025642118 7:63384156-63384178 CTTTGGGAGGCTATGGCAGGAGG + Intergenic
1025704021 7:63846084-63846106 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1025779356 7:64585917-64585939 GTTTGGGAGGCCAAGTGATGTGG - Intergenic
1025836122 7:65095151-65095173 CTTTGGGAGGCTGAGCCATGTGG - Intergenic
1025907278 7:65797263-65797285 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1025930612 7:65990690-65990712 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1025948045 7:66119937-66119959 CTTTGGGAGGCTGAGTGGGGCGG + Intronic
1026038497 7:66846494-66846516 CTTTGGGAGGCTGAGAGAGGTGG + Intergenic
1026040322 7:66862970-66862992 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
1026061789 7:67033138-67033160 CTTTGGGAGGCTCAGGCAGGAGG - Intronic
1026109200 7:67445423-67445445 CTTTGGGAGGCTGAGGGAGGAGG + Intergenic
1026214247 7:68334199-68334221 CTTTGGGAGGCTCAGGCAGGTGG - Intergenic
1026315493 7:69223996-69224018 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1026320855 7:69266511-69266533 CTTTGGGAGGCTGAGGGAAGTGG + Intergenic
1026453060 7:70546198-70546220 CTTTGGGAGGCTGAGGAATGTGG + Intronic
1026492487 7:70874731-70874753 CTTTGGGAGGCTGGGGCATGAGG - Intergenic
1026571590 7:71536237-71536259 CTTTGGGAGGCTCCTAGATCTGG + Intronic
1026610315 7:71853183-71853205 CTTTGGGAGGCTCAGCCAGGAGG - Intronic
1026612367 7:71871501-71871523 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1026687455 7:72523675-72523697 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1026713935 7:72769826-72769848 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1026716554 7:72794310-72794332 CTTTGGGAGGCTCAGGCAGGAGG + Intronic
1026722837 7:72846683-72846705 CTTTGGGAGGCTCAGGCAGGTGG - Intergenic
1026741914 7:72984161-72984183 CTTTGGGAGGCTGAGTCAGGCGG + Intergenic
1026741997 7:72984642-72984664 CTTAGGGAGCCTCTGGGAAGAGG + Intergenic
1026768510 7:73176347-73176369 CTTTGGGAGGCTGAGGCATGCGG - Intergenic
1026801758 7:73404586-73404608 CTTTGGGAGGCTGAGTCAGGCGG + Intergenic
1026801843 7:73405070-73405092 CTTAGGGAGCCTCTGGGAAGAGG + Intergenic
1026813819 7:73493215-73493237 CTTTGGGAGGCTGAGGGAGGCGG + Intronic
1026836115 7:73640531-73640553 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1026871964 7:73858213-73858235 CTTTGGGAGGCGCTGGCAGGCGG + Intergenic
1026994938 7:74609535-74609557 CTTTGGGAGGCTGTGGAAGGAGG - Intergenic
1027009380 7:74729719-74729741 CTTTGGGAGGCTGAGGCATGCGG - Intronic
1027078663 7:75216309-75216331 CTTTGGGAGGCTGAGGCATGCGG + Intergenic
1027101738 7:75380435-75380457 CTTAGGGAGCCTCTGGGAAGAGG - Intergenic
1027101821 7:75380916-75380938 CTTTGGGAGGCTGAGTCAGGCGG - Intergenic
1027372689 7:77522885-77522907 CTTTGGGAGGCTGAGGCATGCGG - Intergenic
1027402992 7:77827885-77827907 CTTTGGGAGGCTAAGTCAGGTGG - Intronic
1027524314 7:79247369-79247391 CTTTGGGAGGCTGAGTTAGGAGG + Intronic
1027924570 7:84444801-84444823 CTTTGGGAGGCTGTGGCAGGCGG - Intronic
1028193775 7:87881161-87881183 CTTTGGGAGGCTGAGTTAGGCGG + Intronic
1029155006 7:98511032-98511054 CTTTGGGAGGCTGAGTCAGGAGG - Intergenic
1029161726 7:98557187-98557209 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1029336031 7:99900027-99900049 CTTTGGGAGGCTGAGTTAGGAGG - Intronic
1029372724 7:100159477-100159499 CTTTGGGAGGCAGAGTCATGTGG + Exonic
1029428505 7:100513385-100513407 CTTAGGGAGGCTGAGTGGTGAGG + Intergenic
1029434730 7:100556639-100556661 CTTGGGTAGGCTCTGGGGTGGGG - Intronic
1029474945 7:100777603-100777625 CTTTGGGAGGCTGAGTGGGGCGG - Intronic
1029633600 7:101768903-101768925 CTTTGGGAGGCTGAGGGACGAGG + Intergenic
1029756179 7:102575056-102575078 CTTTGGGAGGCTGAGTGCAGTGG - Intronic
1029774119 7:102674128-102674150 CTTTGGGAGGCTGAGTGCAGTGG - Intergenic
1029955867 7:104639006-104639028 CTTTGGGAGGCTGAGTGGGGAGG - Intronic
1030052321 7:105549228-105549250 CTTTGGGAGGCTAAGTCAGGTGG - Intronic
1030669034 7:112314548-112314570 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
1031064807 7:117093456-117093478 CTTTGGGAGGCTGAGTGGGGTGG + Intronic
1031410724 7:121437593-121437615 CTTTGGGAGGCTCAGACAGGAGG + Intergenic
1031426094 7:121607514-121607536 CTTTGGGAGGCTGAGTCAGGTGG - Intergenic
1031612915 7:123847532-123847554 CTTTGGGAGGCCCAGTCAGGTGG + Intronic
1031772500 7:125862348-125862370 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1031906861 7:127469921-127469943 CTTTGGGAGGCTGGGGCATGTGG + Intergenic
1032033818 7:128506687-128506709 CTTTGGGAGGCTGTGGCAGGCGG + Intergenic
1032050849 7:128649722-128649744 CTTTGGGAGGCTAAGAGAGGAGG + Intergenic
1032157298 7:129479029-129479051 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
1032307175 7:130746053-130746075 CTTTGGGAGGCTGAGGGAGGAGG + Intergenic
1032363698 7:131279562-131279584 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1032388807 7:131542410-131542432 CTTTGGGAGGCTGAGGCATGAGG + Intronic
1032510685 7:132470023-132470045 CTTTTGGTGGCTCTGGCATGTGG - Intronic
1032619366 7:133512184-133512206 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1032680115 7:134173865-134173887 CTTTGGGAGGCTGTGGCAGGCGG + Intronic
1032741063 7:134739795-134739817 ATTTTGGAGGCTCTTTGTTGAGG + Intergenic
1033298490 7:140163235-140163257 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
1033366371 7:140674997-140675019 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
1033393084 7:140947589-140947611 CTTTGGGAGGCTGAGTCAGGTGG - Intergenic
1033461854 7:141553606-141553628 ATATGGTAGGCTCTGTGCTGGGG - Intronic
1033479703 7:141727617-141727639 GGCTGGGAGGCTCTGTGATTAGG + Intronic
1033709933 7:143932377-143932399 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1033732370 7:144192531-144192553 CTATGGGTGATTCTGTGATGTGG + Intronic
1033743218 7:144291111-144291133 CTATGGGTGATTCTGTGATGTGG + Intergenic
1033750680 7:144358484-144358506 CTATGGGTGATTCTGTGATGTGG - Intronic
1033882805 7:145907321-145907343 CTTTGGGAGGCTGAGTCGTGTGG + Intergenic
1033897726 7:146095291-146095313 CTTTGAGAGGCTCAATGAAGTGG - Intergenic
1034039446 7:147861770-147861792 CTTTGGGAGGCTGAGGCATGAGG + Intronic
1034120461 7:148622118-148622140 CTTTGGGAGGCTGAGGCATGAGG + Intergenic
1034133505 7:148742845-148742867 CTTTGGGAGGCTGAGGGAGGTGG - Intronic
1034452370 7:151143874-151143896 CATTGGCAGGCTCTCTGTTGGGG - Exonic
1034533884 7:151714704-151714726 CTTTGGGAGGCTCGGGCAAGTGG + Intronic
1035344925 7:158191676-158191698 TCTTGGGTGGCTCTGTGATGCGG + Intronic
1035501990 8:97002-97024 CTTTGGGAGGCTCAGTCAGGCGG + Intergenic
1035705870 8:1674286-1674308 CTTTGGGAGGCTGTGGCAGGAGG - Intronic
1035736756 8:1893928-1893950 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
1035745409 8:1959132-1959154 CTTTGGGAGGCTCAGACACGAGG - Intergenic
1035877510 8:3207384-3207406 CTTTGGGAGGCTGAGCCATGCGG - Intronic
1036100779 8:5781958-5781980 CTTTGGGAGGCCCAGTGGGGTGG + Intergenic
1036524168 8:9519534-9519556 CTTTGGGAGGCTAAGTCAGGTGG - Intergenic
1036552811 8:9830033-9830055 CTTTGGGAGGCTCTGTTGGGAGG - Intergenic
1036809142 8:11855261-11855283 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
1036814510 8:11891514-11891536 CTTTGGGAGGCTGAGGTATGAGG - Intergenic
1037008018 8:13806047-13806069 CTTTGGGAGGCTAAGTAAGGTGG + Intergenic
1037104667 8:15091995-15092017 CTTTGGGAGGCCGAGTCATGTGG - Intronic
1037194381 8:16170104-16170126 CTTTGGGAGGCGCAGGGAGGTGG + Intronic
1037229569 8:16640060-16640082 CTGTGGTAGGCTGGGTGATGTGG - Intergenic
1037526109 8:19725664-19725686 CTTTGGGAGGCTGAGTCATGTGG - Intronic
1037543886 8:19899027-19899049 CTTTGGGAGGCTGAGTTAGGTGG - Intergenic
1037562317 8:20086061-20086083 CACTGGGAGGGTCTGGGATGGGG + Intergenic
1037846582 8:22288053-22288075 CTTTGGGAGGCTAAGTCAGGTGG + Intronic
1037853332 8:22350756-22350778 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
1037868682 8:22470228-22470250 CTTTGGGAGGCTATGGCAGGAGG - Intronic
1038458110 8:27691808-27691830 ATCTGGGAGGCTTTGTGATCAGG - Intergenic
1038458940 8:27699683-27699705 CTTTGGGAGGCTCAGGCAGGAGG + Intergenic
1038487968 8:27950007-27950029 CCTAGGGAGGCTCAGTAATGTGG + Intronic
1038551380 8:28472342-28472364 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1038650759 8:29401138-29401160 CTTTGGGAGGCTCAGGCAGGTGG + Intergenic
1038714303 8:29978150-29978172 CCTTGGTAGGCTCTATGTTGAGG - Intergenic
1039183014 8:34887651-34887673 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1039380532 8:37080815-37080837 CTGTGGGAGGCCCTGTAATTGGG - Intergenic
1039497906 8:37995030-37995052 CTTTGGGAGGCTGCGGGAGGTGG - Intergenic
1039795882 8:40914586-40914608 CTTTGGGAGGCTGAGGGAGGAGG + Intergenic
1040029052 8:42807765-42807787 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1040487582 8:47888119-47888141 CTTTGGGAGGCTCAGATAGGAGG - Intronic
1040618481 8:49063474-49063496 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1040920661 8:52612910-52612932 CTTTGGGAGGCTGAGGGAGGAGG - Intergenic
1041027885 8:53705149-53705171 CTTTGGGAGGCTGTGGAAGGAGG + Intergenic
1041073313 8:54146201-54146223 CTTTGGGAGGCCAAGTGAAGTGG + Intronic
1041127669 8:54661068-54661090 CTTTGGGAGGCTAAGTCAGGTGG + Intergenic
1041197888 8:55419139-55419161 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
1041249020 8:55916931-55916953 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
1041421509 8:57672022-57672044 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1041550229 8:59092004-59092026 CTTTGGGAGGCTGGGGCATGTGG + Intronic
1041693425 8:60712804-60712826 CTTTGGGAGGCTGAGTGGGGAGG + Intronic
1041957844 8:63576358-63576380 CTTTGGGAGGCTGAGGCATGAGG - Intergenic
1042193980 8:66216107-66216129 CTTTGGGAGGCTGAGGCATGAGG + Intergenic
1042245059 8:66701515-66701537 CTTTGGGAGGCTGAGTAGTGGGG - Intronic
1042531512 8:69820587-69820609 CTTTAGGAGGCTCAGGGAAGAGG + Intronic
1042537728 8:69875619-69875641 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1043051395 8:75390426-75390448 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1043082107 8:75779643-75779665 CTTTGGGAGGCTGAGGCATGAGG + Intergenic
1043392497 8:79805070-79805092 CTTTGGGAGGCTGAGTGGGGAGG + Intergenic
1043803784 8:84644991-84645013 TTTTGGGAGGCTGAGGGATGTGG - Intronic
1043850596 8:85211884-85211906 CTTTGGGAGGCTGAGTGAGGTGG - Intronic
1044331277 8:90922734-90922756 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
1044680578 8:94773671-94773693 CTTTGGGAGGCTGAGTCAGGCGG - Intronic
1044845792 8:96379738-96379760 CTTTGGGAGGCCGAGTGAGGTGG - Intergenic
1044974259 8:97647833-97647855 CTTTGGGAGGCACTGTTGGGAGG + Intronic
1045000439 8:97873571-97873593 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
1045243702 8:100424581-100424603 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1045263444 8:100597484-100597506 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
1045270178 8:100654767-100654789 CTTTGGGAGGCTGAGGCATGCGG + Intronic
1045739958 8:105346140-105346162 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1046473986 8:114716391-114716413 CTTTGGGAGGCTGTGGGATGGGG + Intergenic
1046493054 8:114978183-114978205 CTTTGGGAGGCTCAGGTAGGAGG - Intergenic
1046625191 8:116569248-116569270 CTTTGGGAGGCTAAGTCAGGAGG + Intergenic
1046941908 8:119939716-119939738 CTTTGGGAGGCTGAGTCAGGCGG - Intronic
1047335536 8:123932350-123932372 CTTTGGGAGGCTGAGTCAGGTGG - Intronic
1047391711 8:124457446-124457468 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1047430504 8:124787036-124787058 CTTTGGGAGGCTCAGGCAGGCGG + Intergenic
1047934522 8:129763821-129763843 CTTTGGGAGGCTCTTGCAGGTGG - Intronic
1047951863 8:129941515-129941537 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
1048012821 8:130471965-130471987 CTTTGGGAGGCTGAGTGGGGAGG + Intergenic
1048462499 8:134633799-134633821 CTTTGGGAGGCCAAGTGAGGTGG + Intronic
1048505689 8:135019074-135019096 CTTTGGGAGGCTGAGTCAGGCGG + Intergenic
1048595060 8:135857925-135857947 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1048856928 8:138694016-138694038 CTCTGGGAGACTCTGTGCTATGG - Intronic
1048922106 8:139240643-139240665 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1049608356 8:143540471-143540493 CTTTGGGAGGCTATGGCAGGAGG - Intronic
1049764083 8:144345025-144345047 CTTTGGGAGGCTGAGAGAGGTGG + Intergenic
1049898835 9:138653-138675 CTTTGGGAGGCTGAGGCATGAGG + Intronic
1049994354 9:1020502-1020524 CTTTGGGAGGCTGAGTCAAGTGG - Intergenic
1050247706 9:3708355-3708377 CTTTGGGAGGCTGTGGCAGGTGG + Intergenic
1050277555 9:4015642-4015664 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1050312222 9:4365312-4365334 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
1050415328 9:5410290-5410312 CTTTGGGAGGCTGAGTCAAGTGG + Intronic
1050611743 9:7360763-7360785 CTTTGGGAGCCTCTTTGGTTTGG + Intergenic
1051302770 9:15670897-15670919 CTTTGGGAGGCTCTGGTGGGAGG + Intronic
1051510741 9:17875224-17875246 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1051632074 9:19149680-19149702 CTTTGGGAGGCTGAGGCATGAGG + Intergenic
1051820283 9:21157879-21157901 CTTTGGGAGGCTGAGGCATGTGG + Intergenic
1052344051 9:27390443-27390465 CTTTGGGAGGCTGAGTGGGGAGG - Intronic
1052790397 9:32870172-32870194 CTTTGGGAGGCTGAGTGGGGAGG - Intergenic
1052846146 9:33338109-33338131 CTTTGGGAGGCCATGGGAGGTGG + Intronic
1052924674 9:34004857-34004879 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1053015157 9:34657618-34657640 CATTTGGGGTCTCTGTGATGGGG - Intronic
1053027991 9:34747162-34747184 CTTTGGGAGACTGTGGGTTGGGG + Intergenic
1053492999 9:38525163-38525185 CTTTGGGAGGCTGAGTCAGGCGG + Intergenic
1053703374 9:40724802-40724824 CTTTGGGAGGCTGAGGGAGGCGG + Intergenic
1053741888 9:41148964-41148986 CTTTGGGAGGCTGAGGCATGAGG + Intronic
1054347149 9:63978765-63978787 CTTTGGGAGGCTGAGGCATGAGG + Intergenic
1054413431 9:64848266-64848288 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1054444883 9:65305107-65305129 CTTTGGGAGGCTGAGGCATGAGG + Intergenic
1054485388 9:65716399-65716421 CTTTGGGAGGCTGAGGCATGAGG - Intronic
1054686455 9:68282336-68282358 CTTTGGGAGGCTGAGGCATGAGG - Intronic
1054805216 9:69391025-69391047 CTTTGGGAGGCTGAGTCAGGAGG - Intronic
1054927062 9:70600286-70600308 CTTTGAGAGGTTCTGAGGTGGGG - Intronic
1055004337 9:71488533-71488555 CTTTGGGAGGCTGTGGCAGGAGG + Intergenic
1055009162 9:71544765-71544787 CTTTGGGAGGCTGAGTCAAGTGG + Intergenic
1055062705 9:72087162-72087184 TTTTGGGAGGCTGAGTGAGGAGG - Intergenic
1055065267 9:72112250-72112272 CTTTGGGAGGCTCAGGCAGGTGG + Intergenic
1055357791 9:75455263-75455285 CCATGGGAGGCCCTGTTATGAGG + Intergenic
1055392318 9:75836420-75836442 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1055419741 9:76126368-76126390 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1055472084 9:76621927-76621949 CTTTGGGAGGCTGAGTGGGGAGG - Intronic
1055526941 9:77144302-77144324 CTTTGGGAGGCTGAGGGAGGAGG + Intergenic
1055738830 9:79363386-79363408 CTTTGGGAGGCCCAGTCAGGAGG + Intergenic
1055756464 9:79563570-79563592 CTTTGGGAGGCTGAGGGAGGTGG + Intergenic
1056157083 9:83849055-83849077 CTTTGGGAGGCTGAGTCAAGAGG - Intronic
1056241995 9:84656984-84657006 CTTTGGGAGGCTGAGTCAGGTGG + Intergenic
1056353458 9:85775057-85775079 CTTTGGGAGGCTGAGTCAAGAGG + Intergenic
1056441238 9:86623350-86623372 CTTTGGGAGGCTCAGGTAGGTGG - Intergenic
1056744294 9:89286742-89286764 GTTTTGGAGGCTGTCTGATGGGG - Intergenic
1056777134 9:89521455-89521477 CTTTGGGAGGCTGAGTCAGGAGG + Intergenic
1056991507 9:91415868-91415890 CTTTGGGAGGCTGTGGCAGGCGG - Intronic
1056993627 9:91434169-91434191 CTTTGGGAGGCTGAGGCATGAGG + Intergenic
1057025973 9:91734009-91734031 CTCTGGAAGGTTCTGTGATAAGG + Intronic
1057241922 9:93418773-93418795 CTTTGGGAGGCTGAGAGAGGCGG + Intergenic
1057247931 9:93473553-93473575 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
1057505581 9:95630830-95630852 CATTGGGTGGCTCTGTCATCTGG + Intergenic
1057644613 9:96861001-96861023 CTTTGGGAGGCTGAGAGAGGAGG + Intronic
1057687861 9:97252276-97252298 CTTTGGGAGGCTAAGGCATGTGG + Intergenic
1057907539 9:98994135-98994157 GTTGGGGAGGCACTGTGTTGGGG + Intronic
1057998704 9:99844007-99844029 CTTTGGGAGGCTGGGGGGTGGGG - Intronic
1058008062 9:99940722-99940744 CTTTGGGAGGCTGAGTCAGGCGG - Intronic
1058143310 9:101381276-101381298 CTTTGGGAGGCTGAGGTATGAGG + Intronic
1058178389 9:101766082-101766104 CTTTGGGAGGCTGTGGCAGGTGG + Intergenic
1058301417 9:103378400-103378422 CTTTGGGAGGCTGAGTAAGGAGG - Intergenic
1059576325 9:115492640-115492662 CTTTGGGAGGCTGTGGCAAGTGG - Intergenic
1059645425 9:116261967-116261989 CTTTGGGAGGCCGAGTGAGGAGG + Intronic
1060455108 9:123785094-123785116 CTTTGGGAGGCTGAGGGAAGAGG + Intronic
1060563186 9:124565183-124565205 CTTTGGGAGGCTCTGGCGGGCGG + Intronic
1060653548 9:125351982-125352004 CTTTGGGAGGCTGAGTTAGGTGG - Intronic
1060851306 9:126878965-126878987 CTTTGGGAGGCTGAGGGAGGCGG - Intronic
1060937355 9:127523335-127523357 CTCTTGGAGGCTCTGTAAAGTGG - Intronic
1061155357 9:128857450-128857472 CTTTGGGAAGCTGAGTGAAGCGG - Intronic
1061240424 9:129367901-129367923 CTTTGGGAGGCTGAGGGTTGTGG + Intergenic
1061281628 9:129601011-129601033 CTGTGGCAGGCTCTGTGTTAGGG + Intergenic
1061501386 9:131004748-131004770 CTTTGGGAGGCCCAGTCAGGTGG - Intergenic
1061513468 9:131075018-131075040 CTTTGGGAGGCTGAGGCATGAGG + Intronic
1061595004 9:131623218-131623240 CTTTGGGAGGCTGAGGGAGGAGG + Intronic
1061629680 9:131864235-131864257 CTTTGGGAGGCTGAGTCAGGGGG + Intronic
1061683459 9:132256478-132256500 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1061691823 9:132339238-132339260 CTTTGGGAGGCTGAGGTATGGGG + Intronic
1062356481 9:136166725-136166747 CTTTGGGAGGCCTTGTCAGGAGG - Intergenic
1062361150 9:136188803-136188825 CTTTGGGAGGCTGGGGGGTGGGG + Intergenic
1062599841 9:137314793-137314815 CTTTTGGGGGCTCTGGGGTGAGG - Intronic
1203576698 Un_KI270745v1:14465-14487 CTTTGGGAGGCTAAGAGAGGAGG + Intergenic
1203577095 Un_KI270745v1:17887-17909 CTTTGGGAGGCTAAGAGAGGAGG + Intergenic
1203606332 Un_KI270748v1:60408-60430 CTTTGGGAGGCTCAGTCAGGCGG - Intergenic
1185556536 X:1025805-1025827 CTTTGGGAGGCTGAGGGAGGGGG + Intergenic
1185684771 X:1919246-1919268 CTTTGGGAGGCTCAGGCAGGCGG + Intergenic
1185723206 X:2398423-2398445 CTTTGGGAGGCTCAGGTAGGAGG + Intronic
1185783630 X:2870444-2870466 CTTTGGGAGGCTCAGGCAGGTGG - Intronic
1186087874 X:6010768-6010790 CGTTGGGAGGCTATGGGAGGTGG - Intronic
1186164223 X:6809538-6809560 CTTTGGGAGGCTGAGGGAGGAGG - Intergenic
1186444396 X:9614322-9614344 CTTTGGGAGGCTGAGTCAGGAGG + Intronic
1186566813 X:10671979-10672001 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1187359632 X:18612984-18613006 CTTTGGGAGGCTCAGGCAGGAGG + Intronic
1187381032 X:18802313-18802335 CTTTGGGAGGCTGAGTCAGGAGG - Intronic
1187404674 X:18992532-18992554 CTTTGGGAGGCTAAGTTAGGAGG - Intronic
1187416318 X:19096165-19096187 CTTTGGGAGGCTGAGTCAGGCGG + Intronic
1187938479 X:24359409-24359431 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1188149056 X:26649842-26649864 CTTTGGGAGGCTGGGGGAGGGGG + Intergenic
1188423990 X:30025060-30025082 CTTTGGGAGGCTGAGGGAGGAGG + Intergenic
1188451770 X:30314784-30314806 CTTTGGGAGGCTGAGGGAGGCGG - Intergenic
1188906234 X:35795106-35795128 CTTTGGGAGGCTGAGGCATGCGG - Intergenic
1189406614 X:40730892-40730914 CTTTGGGAGGCTTGGTGGCGGGG + Intronic
1189810912 X:44779919-44779941 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1190077075 X:47325121-47325143 CTTTGGGAGGCTGAGTCAGGTGG - Intergenic
1190569982 X:51770882-51770904 CTTTGGGAGGCTGAGGGAGGTGG - Intergenic
1190809201 X:53866990-53867012 CTTTGGGAGGCTCGGTAGGGTGG + Intergenic
1190851945 X:54253372-54253394 CTTTGGGAGGCTGAGGGAGGAGG - Intronic
1191887417 X:65903059-65903081 CTTTGGGAGGCTTAGGGGTGTGG + Intergenic
1192484037 X:71509726-71509748 CTTTGGGAGGCTGAGGCATGTGG + Intronic
1193233231 X:79074098-79074120 CTTTGGGAGGCCATGGCATGTGG + Intergenic
1193300159 X:79880121-79880143 CTTTGGGAGGCTGTGGCAGGTGG + Intergenic
1195936797 X:110133392-110133414 CTTTGGGAGGCTGAGGCATGTGG - Intronic
1196092338 X:111758854-111758876 CTTTGGGAGGCTGTGGCAGGTGG + Intronic
1196321225 X:114342302-114342324 CTTTGGGAGGCTGAGTTAGGTGG - Intergenic
1196410303 X:115411600-115411622 CTTTGGGAGGCTGAGGGAGGAGG - Intergenic
1196424050 X:115551865-115551887 CTTTGGGAGGCTGAGGGAGGCGG - Intergenic
1196841609 X:119864562-119864584 CTTTGGGAGGCTGAGGGATGAGG + Intergenic
1196963206 X:121026404-121026426 CTTTGGGAGGCTGAGTCAGGTGG - Intergenic
1197380446 X:125731771-125731793 CTTTGGGAGGCTGAGTCAGGTGG - Intergenic
1197736428 X:129852586-129852608 CTTTGGCTGCCTCTGTGATCTGG - Intergenic
1197744185 X:129919943-129919965 CTTTGGGAGGCTCAGGCAGGTGG + Intronic
1198017003 X:132621299-132621321 CTTTGGGAGGCTGAGTGGGGAGG - Intergenic
1198017380 X:132625043-132625065 CCTTGGGAGGATCTGTGAACAGG - Intergenic
1198382867 X:136100520-136100542 CTTTGGGAGGCTGAGTGGGGTGG + Intergenic
1198628344 X:138604928-138604950 CTTTGGGAGGCTGGGGGGTGGGG + Intergenic
1198742965 X:139860572-139860594 CTTTGGGAGGCTGAGGGAGGTGG + Intronic
1198749216 X:139921959-139921981 CTTTGGGAGGCTGAGTCAGGTGG + Intronic
1198750711 X:139933702-139933724 CTTTGGGAAGGCCTGTGGTGTGG - Intronic
1199150254 X:144423989-144424011 CTTTGGGAGGCTGAGTGGGGTGG - Intergenic
1199404516 X:147441516-147441538 TTTTTGGAGGGTATGTGATGGGG + Intergenic
1199623065 X:149716050-149716072 CTTTGGGAGCCTATCTGATGAGG + Exonic
1200237374 X:154474389-154474411 CTTTGGGAGGCTGAGGGGTGAGG - Intergenic
1200796349 Y:7344549-7344571 CTTTGGGAGGCCCTGAGGTTGGG + Intergenic
1200805257 Y:7427311-7427333 CTGGAGGAGGCTCTGTGGTGTGG + Intergenic
1200817608 Y:7549794-7549816 CTTTGGGAGGCTCAGACAGGCGG + Intergenic
1201281248 Y:12344300-12344322 CTTTGGGAGGCTGAGGGAGGAGG - Intergenic
1201291774 Y:12426996-12427018 CTTTGGGAGGCTGAGTCAGGAGG - Intergenic
1201426565 Y:13857834-13857856 CTTTGGGAGGCTTAGGCATGAGG + Intergenic
1201474883 Y:14369781-14369803 CTTTGGGAGGCTGAGTCAGGAGG - Intergenic
1201628612 Y:16043287-16043309 ATTTGGGAGGCTGTGGGGTGAGG - Intergenic
1201667607 Y:16476598-16476620 CTTTGGGAGGCTGAGTTGTGTGG + Intergenic
1201738141 Y:17293254-17293276 CTTTGGGTGGCTCAGTTAGGAGG - Intergenic
1201893731 Y:18971421-18971443 TTTTGGGAGGCTGTGTGGTGGGG + Intergenic
1201901718 Y:19050392-19050414 CTTTGGGAGGCTGAGGCATGTGG - Intergenic
1201909652 Y:19121075-19121097 CTTTGGGAGGCTGTGGTAGGTGG + Intergenic
1202045533 Y:20734235-20734257 CTTTGGGAGGCTGAGACATGAGG + Intergenic
1202388485 Y:24346826-24346848 CTTTGGGAGGCTCAGTCAGACGG - Intergenic
1202482302 Y:25323302-25323324 CTTTGGGAGGCTCAGTCAGACGG + Intergenic