ID: 952953627

View in Genome Browser
Species Human (GRCh38)
Location 3:38543364-38543386
Sequence CTGTGCCAGGTGCTGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 988
Summary {0: 1, 1: 0, 2: 7, 3: 113, 4: 867}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952953619_952953627 -10 Left 952953619 3:38543351-38543373 CCCAGCTCCTTATCTGTGCCAGG 0: 1
1: 0
2: 1
3: 56
4: 323
Right 952953627 3:38543364-38543386 CTGTGCCAGGTGCTGGGGCAGGG 0: 1
1: 0
2: 7
3: 113
4: 867

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952953627 Original CRISPR CTGTGCCAGGTGCTGGGGCA GGG Intergenic
900001074 1:15175-15197 CAGTGCCCGGTGCTGGGTCAGGG - Intergenic
900020788 1:185696-185718 CAGTGCCTGGTGCTGGGTCAGGG - Intergenic
900104060 1:974735-974757 TGGTGCCAGCAGCTGGGGCAGGG + Exonic
900323448 1:2095968-2095990 CTGTGCCAGGGGCCAGGGCAGGG + Intronic
900341943 1:2193737-2193759 AGGTGCCGGGCGCTGGGGCAGGG + Exonic
900351676 1:2238024-2238046 CTGTGCCAGGCGCTGGGCTGTGG + Intronic
900373727 1:2343966-2343988 CTGGGCCTGGGGCTGGGGCCAGG + Intronic
900429446 1:2594912-2594934 CACTGCCAGATGCTGGGGCCGGG + Intronic
900604107 1:3516220-3516242 CTGTGCCCTGAGCTGGCGCAGGG + Intronic
900867496 1:5278690-5278712 CTGTGCCAGGCGGCAGGGCAGGG - Intergenic
900919424 1:5661342-5661364 ATGTGGCAGGTGCTGGTGCGTGG - Intergenic
901065472 1:6492160-6492182 CTGTGCCAGGCGCTAAGGCAGGG + Intronic
901079217 1:6574458-6574480 CTGGGGCAGGTTCTGGGGGAGGG - Intronic
901572894 1:10175994-10176016 GGTTGCCAGGGGCTGGGGCAAGG - Intronic
901627001 1:10630195-10630217 CTGGGCCTGGGGCTGGGGCTGGG - Exonic
902046490 1:13528612-13528634 ATGGGCCAGATGCTGGGACAGGG - Intergenic
902078407 1:13804953-13804975 CTGTGTCAGGGAGTGGGGCATGG + Intronic
902330977 1:15731138-15731160 CTGTCCCAGGAACTGGGGCCAGG - Intronic
902332271 1:15736442-15736464 CTGTGCCCGGGTCAGGGGCACGG - Exonic
902631167 1:17705533-17705555 CTGGGCCATGAGCTGGGGCTGGG + Intergenic
902757755 1:18560344-18560366 CTGTGCCTGGCCCTGGGACAAGG - Intergenic
902764765 1:18606898-18606920 AGGTGCCAGGTGCAGGTGCACGG - Intergenic
902943435 1:19816513-19816535 CAGTGCCAGCTACTGGGGTAAGG - Intergenic
903051526 1:20604717-20604739 CAGTGCCAGGTTCTTGGGAAGGG + Intronic
903131538 1:21282633-21282655 CTGTGCCTGGTGCTGGCTCCAGG + Intronic
903183880 1:21618887-21618909 GTGTGCCAGGTGCGGGGGTAGGG - Intronic
903339145 1:22643414-22643436 CTCAGCCAGATGCTGGGGCAGGG + Intergenic
903512576 1:23887315-23887337 GGGTGGCAGGTGATGGGGCAGGG - Intronic
903539804 1:24090478-24090500 ATCTGACAGGTGCTGGGGTAGGG + Intronic
903557862 1:24206404-24206426 CTGTGCCTGGGGCTGGGGAAGGG - Intergenic
903937613 1:26907430-26907452 CTGTACTAGATGCTGGGGTAGGG - Intronic
903972421 1:27127683-27127705 CTATGCCAGGTGCTGAGCCTGGG - Intronic
904063052 1:27726153-27726175 CTGTGCAAGGTGCGCGGGCTGGG + Exonic
904841464 1:33374387-33374409 CAGGGCCAGGTGCTGGGGCTAGG + Intronic
905058778 1:35121646-35121668 CTGCTCCAGGAGCTGGGGAAGGG - Intergenic
905292977 1:36935560-36935582 CTTTGCTGGGTGCGGGGGCAGGG - Intronic
905305332 1:37013925-37013947 GGGTGCAAGGGGCTGGGGCAAGG - Intronic
905871009 1:41404628-41404650 CTGTGCTGGGAGCTGGGGGAGGG + Intergenic
905894706 1:41537951-41537973 CTGAGCCTGGCGCTGGGCCAGGG + Intronic
906082301 1:43101355-43101377 CTGTGGCAGGTCCAGGTGCATGG + Intergenic
906322988 1:44828141-44828163 CTGCCCCAGGAGCTGGGGGACGG - Exonic
906683212 1:47744957-47744979 CTGTGCTAGATCCTGGGGTAGGG - Intergenic
906686668 1:47767450-47767472 CAGAGCCTGGTGCAGGGGCAGGG - Intronic
906936809 1:50221356-50221378 CTGTGCTAGTTGCTGAGGCCGGG - Intergenic
907246812 1:53114082-53114104 CTGTGCCAGGCCCTGGACCAGGG - Intronic
907306922 1:53518405-53518427 GTGTGCCAGGTGCTGCTCCAGGG - Intronic
907315963 1:53572792-53572814 CATTGCCTGGAGCTGGGGCAAGG + Intronic
907417805 1:54326551-54326573 CAGTGCCAGGAGCTGCGTCAAGG - Intronic
907456838 1:54581612-54581634 CTGTGCCAAGTGCTGGCCCCAGG - Intronic
907458592 1:54592052-54592074 CTGTGCCATGTGCTAGGCCTTGG + Intronic
907489326 1:54799158-54799180 CTGTGCTGTGTCCTGGGGCATGG - Intronic
907830921 1:58063467-58063489 CTGTGCCAAGTGTGGGGGCCCGG - Intronic
907990427 1:59577129-59577151 CTGTACCAGGTGCTGGGAGGAGG - Intronic
908577217 1:65473125-65473147 CTGTGCCAGGGTCTGTGCCAAGG + Intronic
909618282 1:77637533-77637555 ATTAGCCAGGTGCAGGGGCAGGG + Intronic
910366287 1:86468701-86468723 CTGTGCCAGATGCTGGGGTAAGG - Exonic
910466394 1:87504836-87504858 ATGTGCCAGGTACTGTGCCAAGG - Intergenic
911090093 1:94011159-94011181 CTGTGGCAGGGGCTGGTGCTAGG - Intronic
912316297 1:108670211-108670233 CTGTGCCAGGGGATGAGGAAAGG - Intergenic
912625554 1:111202906-111202928 AAGTGCCTGGTGTTGGGGCAGGG + Intronic
912688696 1:111787232-111787254 ATGTGCCAGGTACTGTGACATGG + Intronic
913207649 1:116555930-116555952 CTGTGCCAGGCACTGTTGCAAGG + Intronic
913218307 1:116639008-116639030 CTGTACCAGGTGCTATGGAAGGG + Intronic
913258131 1:116973765-116973787 CTGTGCTGGGTGCTGGGGAAAGG - Intronic
913317725 1:117566663-117566685 CTGGGCCAAGTGCTGGGGAGTGG + Intergenic
913665895 1:121048700-121048722 CTGAGGCAGGTGAGGGGGCAAGG - Intergenic
913937236 1:125065929-125065951 CTGTGTCTGGGGCTGGGGCTGGG - Intergenic
914017293 1:143831976-143831998 CTGAGGCAGGTGAGGGGGCAAGG - Intergenic
914069659 1:144276195-144276217 CTGTACCAGCAGCTGGCGCAGGG - Intergenic
914109496 1:144690159-144690181 CTGTACCAGCAGCTGGCGCAGGG + Intergenic
915117178 1:153608415-153608437 TGGTGCCTGGGGCTGGGGCAGGG - Intronic
915143152 1:153779203-153779225 CTGTGCCAGGTGCCTAGGCATGG + Exonic
915283568 1:154838820-154838842 CTGTGCAAGGTGCTGGGGGTGGG - Intronic
915294399 1:154909968-154909990 CCTTGCCAGGAGTTGGGGCAGGG + Intergenic
915332251 1:155120316-155120338 CTCTGACTGGGGCTGGGGCAGGG - Intergenic
915590698 1:156868570-156868592 CGGTGCCAGGTGGAGGGGCGGGG + Exonic
915743996 1:158142152-158142174 CTATGGCAGGGGCGGGGGCAGGG + Intergenic
915955806 1:160219068-160219090 CTGAGGCAGCTGCTGGGGAAGGG + Intronic
916564441 1:165961142-165961164 CTGTGCTAGGTGCTGAGGATGGG + Intergenic
916582329 1:166120148-166120170 CTGTGCCAGGTGCTGTGCTGGGG + Intronic
916653174 1:166849556-166849578 TTCCGGCAGGTGCTGGGGCACGG - Exonic
916730062 1:167558053-167558075 CTGTGCTCGGTGCTGGGAGACGG - Intergenic
916791519 1:168129475-168129497 CTGTGCCTGCTGCTGGGTGAAGG + Intronic
916939401 1:169663682-169663704 CTGTTGCAGGTTCTTGGGCAGGG + Intronic
917070300 1:171142996-171143018 CTGTGCCAGGTGCTACGCGAAGG + Intronic
917497832 1:175557490-175557512 CTGTCCAAGGTGCTGGGGAGAGG - Intronic
917639063 1:176964792-176964814 CTGTGCCAGTTTCTGTGCCAGGG + Intronic
917834765 1:178932653-178932675 CTGTGCTAGGTTCTGGGGAAGGG + Intergenic
918309736 1:183277070-183277092 GTATGTCAGGTGCTGGGGCTAGG + Intronic
919060635 1:192628075-192628097 CCGTGTCAGCTGCTGGGTCAGGG - Intergenic
919469139 1:197957271-197957293 CGGTTCCAGGTGCTGGGATATGG + Intergenic
920038659 1:203082126-203082148 CTGAGCCCGGAGCTGGTGCAGGG + Intergenic
920095468 1:203483687-203483709 CTGCTCCAGGTTCCGGGGCAGGG - Exonic
920295973 1:204956656-204956678 CTGTGCTAGGTGCTGGTGAAAGG - Intronic
920378410 1:205521899-205521921 CTGTGCCTGGTGCTGGTGCATGG + Intronic
921217544 1:212950646-212950668 CTGGGCCTGGGGCTGGGGCTGGG - Exonic
922468343 1:225860205-225860227 CTGTGCAAGGAGCTGAGGCAGGG + Intronic
922551205 1:226495839-226495861 CTGTTCCAGGTCCTGGCTCAGGG - Intergenic
922792409 1:228317613-228317635 CTGTGCCACGAGCTGGTGCCTGG + Exonic
922996757 1:229970417-229970439 GGTTGCCAGGGGCTGGGGCAGGG + Intergenic
923092787 1:230752643-230752665 CTGTGCTAGCTCCTGGGGCAGGG - Intronic
923519502 1:234725014-234725036 CTCTGCCTGCTGCTGGAGCATGG + Intergenic
1064328386 10:14372129-14372151 CTGTACCAGGCCCTGGGTCATGG - Intronic
1064813574 10:19230681-19230703 CTGTTCCAGGTTCTGGGAAAAGG + Intronic
1065060874 10:21899436-21899458 CTGAGACAGGACCTGGGGCAAGG + Intronic
1065082292 10:22140470-22140492 CTGTTGCAGGTTCTTGGGCAGGG + Intergenic
1065143589 10:22743964-22743986 CTGTGCCAGGTGCTGGAAAAGGG + Intergenic
1066431617 10:35357184-35357206 CTGGGGCTGGGGCTGGGGCAGGG - Intronic
1066658454 10:37716987-37717009 CTGGGCCAGGTGGAGTGGCAAGG - Intergenic
1067536206 10:47112095-47112117 CTGTGCTACCTGCTGCGGCATGG + Intergenic
1067777506 10:49174244-49174266 CTGAGGCAGGGGCAGGGGCAGGG - Intronic
1067829149 10:49600103-49600125 CGGCACCAGGTGCTGGGACACGG + Intergenic
1069001032 10:63265267-63265289 CTGTGCTTGGTGCAGGGGCGGGG - Intronic
1069228541 10:65975649-65975671 CTGTGCCAGGTACTATGCCAAGG + Intronic
1069394742 10:67976685-67976707 CTCTGCCAGGGGCTGGGAGAGGG - Intronic
1069565633 10:69461651-69461673 GTGTGCCAGGTGCTGGGTGCAGG + Intronic
1069817585 10:71208413-71208435 GGGTGCCAGGGGCTGGGGGAGGG + Intergenic
1069891083 10:71652862-71652884 CTGGGCCAGGGGCTGGTTCAGGG + Intronic
1070503774 10:77095474-77095496 TAGTGCCTGGTGCTGGGTCAGGG + Intronic
1070756272 10:78995274-78995296 CTGTGCCAGGCACTGGGCAAGGG - Intergenic
1070769245 10:79072734-79072756 CAGTGACAGGGGCTGGGCCAGGG - Intronic
1070937497 10:80312685-80312707 GGTTGCCAGGTGCTGGGGGAAGG + Intergenic
1071437349 10:85659782-85659804 CTGTGCCATGTGCTGTTACATGG + Intronic
1071520818 10:86330540-86330562 CTGTTCCCGGTGCTTGGTCAGGG - Intronic
1071955252 10:90750922-90750944 CTGTTCCAGGTGTTGGGGATAGG + Intronic
1072610840 10:97016957-97016979 CTGTGGTACGAGCTGGGGCAGGG + Intronic
1072668078 10:97408994-97409016 CTGTGCCAGGCACTGGGCTAAGG - Intronic
1072934453 10:99698920-99698942 CTGTGCCAGGTGCTGTGCAAAGG + Intronic
1073190905 10:101650104-101650126 TTGTGCCAGGAGCTTGGGGATGG - Intronic
1073271128 10:102265029-102265051 CTGTGGCATGGGATGGGGCATGG + Intronic
1073301896 10:102475932-102475954 CTGTGACAGGTTCTGGCGCTGGG - Exonic
1073364105 10:102923305-102923327 CTGTGCCAGGTACAGGGGCTGGG + Intronic
1074536930 10:114334770-114334792 CTCTGCCATGTGCTGGAGAAGGG - Intronic
1074703220 10:116110271-116110293 CTGTGCCAGGCACTGGGCTATGG + Intronic
1074742731 10:116500537-116500559 CTGTTGCAGGTTCTTGGGCAGGG + Intergenic
1075484532 10:122811406-122811428 CTGTGCCAGGGACTGTGCCAGGG - Intergenic
1075511328 10:123074820-123074842 CTATGCCAAGTGCTGGGGGACGG - Intergenic
1075536814 10:123278390-123278412 CTGGGGCAGAGGCTGGGGCATGG - Intergenic
1075821908 10:125321779-125321801 CTGTCCTAAGTGCTGGGGTATGG - Intergenic
1075891163 10:125952532-125952554 GTGTATCAGGTGCTGGGGCTGGG + Intronic
1076519464 10:131071963-131071985 GTGGGCCAGGGGCTGGGGCTGGG - Intergenic
1076659419 10:132045418-132045440 CTGTGCCAGGTGCGGGTAGAGGG - Intergenic
1076662256 10:132063341-132063363 CCATCCCAGGTGCTGGGGCTCGG + Intergenic
1076865888 10:133166105-133166127 CAGTGCCAGCCGCTGGGGCAGGG + Intronic
1076888178 10:133272021-133272043 CTGTGCCAAGTCCTGGGCCCTGG - Intronic
1077081451 11:726243-726265 CTGGGCCGGGGGCGGGGGCAGGG + Intronic
1077094994 11:795482-795504 CAGTGCCAGGGGCCGGGGCCAGG + Intronic
1077221881 11:1421587-1421609 CAGTGCCAGGTGCAGAGGGAAGG - Intronic
1077386960 11:2274264-2274286 GGGTGCCAGGGGCTGGGGGAAGG - Intergenic
1077437272 11:2548997-2549019 TGGTGACAGGTGCTGGGGCCCGG + Intronic
1077509875 11:2952988-2953010 CTGTGCCAGGTGCTATGTTAAGG + Intronic
1077552216 11:3205593-3205615 CCGTGGCAGGTCCTGGGGCCGGG + Intergenic
1078012006 11:7579590-7579612 CTGCCCCAGGGGCTGGGACAAGG - Intronic
1078185312 11:9047120-9047142 CTATGCCAGGTGCTGAGGACAGG + Intronic
1078690769 11:13578674-13578696 CACTGCCAGGAGATGGGGCAGGG - Intergenic
1078706203 11:13746570-13746592 CTGTGTCAGGTTCTTGGTCAGGG + Intergenic
1078992505 11:16664326-16664348 CTGTGCCAGGGGATGGGGTAGGG - Intronic
1079114670 11:17633781-17633803 CACTGCCAGGTGCTGGGCGAGGG + Exonic
1079170686 11:18092407-18092429 CTGAGCCAAGTTTTGGGGCAAGG + Intronic
1079621576 11:22562023-22562045 CTGTGCCAGGTACTGTGCTAAGG + Intergenic
1080711025 11:34748375-34748397 CTGTGTCTGATGCTTGGGCAGGG + Intergenic
1081576074 11:44319258-44319280 CTATGACAGGTGCTAGGGCAGGG - Intergenic
1081747982 11:45486394-45486416 CTGTGCCAGGAGCTTGGGATGGG + Intergenic
1082009862 11:47442592-47442614 GTGGGCCAGGGGCTGGGGCCTGG - Intronic
1082787733 11:57326094-57326116 CTGTTCAAGTTGCTGGAGCAGGG - Exonic
1083236910 11:61356928-61356950 CACTGCCAGGTGCTGGGGTGGGG - Intronic
1083421561 11:62556196-62556218 CTGTGCCATGTGCTGGACCATGG + Intronic
1083614977 11:64021776-64021798 GTGTGCCAGGCGCTGGGACACGG + Intronic
1083692484 11:64418806-64418828 GGGTGCCAGGGGCTGGGGGAGGG + Intergenic
1083718914 11:64594402-64594424 ATGTGCCAGGTGCTCGGCAAGGG - Intronic
1083903407 11:65654800-65654822 CTGGGACAGGGGCTGGGGCCTGG + Exonic
1083992908 11:66257849-66257871 CTGCGCCTGGTGCTCGGGCCCGG - Intronic
1084318617 11:68360586-68360608 CTGTGACTGTGGCTGGGGCAAGG + Intronic
1084432231 11:69117502-69117524 CTGAGCGAGGCGCTGGGGAAGGG + Intergenic
1084549579 11:69833153-69833175 CTGTCCCAGCTGCTGGTGCACGG + Intergenic
1084889474 11:72229652-72229674 CTGTGGCAGGTTCTGGGGGGAGG - Exonic
1085084920 11:73660676-73660698 CTGTGCCAGGCGTGGGGGTAGGG + Intronic
1085175948 11:74488363-74488385 CTGTGCCAGGCCCTGAGCCAGGG + Intergenic
1085254014 11:75162182-75162204 CTGGGGCAGGTGCAGGGTCAAGG - Intronic
1085298721 11:75445893-75445915 GTGTGCCAGGTCCTGGGCTAGGG - Intronic
1085439163 11:76542261-76542283 CTGAGCCACATGCTGGAGCAGGG - Exonic
1085528329 11:77176836-77176858 CTGTGCTAGATGCTGGGGAGGGG - Intronic
1085730828 11:78997030-78997052 CTGTGCAAGTTGTTGGGGCGGGG + Intronic
1085823159 11:79814808-79814830 CTGGGCTACGTGCTGGCGCATGG - Intergenic
1086178416 11:83920042-83920064 CTGTGTCAGGGTCTGTGGCATGG - Intronic
1086643502 11:89189643-89189665 CTGTGCCAAGTGCTGAGGCTGGG - Intronic
1086983477 11:93223836-93223858 CAGTGTCAGGGGCTGGGTCATGG + Intergenic
1087459111 11:98423413-98423435 CTGTTGCAGGTTCTTGGGCAGGG - Intergenic
1087990959 11:104744816-104744838 CTGGGATAGGTGTTGGGGCAGGG - Intergenic
1088364271 11:109022445-109022467 CTGTGCTAGGTGCTGGGGATAGG - Intergenic
1088678250 11:112217294-112217316 CTGTGCTAGGTTCTGGGGAGAGG + Intronic
1088918203 11:114242936-114242958 CAGTTCCAGGTGATGGGACAAGG + Intronic
1089140015 11:116277122-116277144 CTGTGGCCGGTGGTGGGGCCAGG - Intergenic
1089498936 11:118921836-118921858 CTGTGCTAGCTGGTGGGGAAGGG - Intronic
1089511195 11:118998309-118998331 CTGCCCCAGGTGCGGAGGCAAGG + Exonic
1089690088 11:120181745-120181767 CTGAGCCAGGTCCTGGGCTATGG + Intronic
1089759817 11:120715166-120715188 CTGGGCCAGGTGCTGGGATTCGG + Intronic
1090089339 11:123680866-123680888 GTTTGCCAGGGGCTGGGGGATGG - Intergenic
1090434774 11:126677624-126677646 CTGTGCTAGGTGCTGAAGCAGGG + Intronic
1091300030 11:134501928-134501950 GTGGGCCAGGTCCAGGGGCAGGG + Intergenic
1091331899 11:134737031-134737053 CTGTGCCAGGTGGAGGGGCCTGG - Intergenic
1091374163 12:15290-15312 CAGTGCCCGGTGCTGGGTCAGGG - Intergenic
1091391586 12:129435-129457 TTGTGACAGGTGCTGGGGAAGGG - Intronic
1091400863 12:179781-179803 CTGTGCCAGATGCGGGCCCATGG + Intergenic
1091434013 12:459897-459919 CTGTGCCCGGGGCGGGGGCGGGG + Intergenic
1091516190 12:1184898-1184920 CTTAGCCAGGTGTTGTGGCATGG - Intronic
1091535398 12:1403277-1403299 CCGTGCCAGGTGCATGTGCAGGG - Intronic
1091618570 12:2068288-2068310 ATGTGACAGGGACTGGGGCAGGG - Intronic
1091630074 12:2153479-2153501 GGGTGCCAGGGGCTGGGGGAAGG - Intronic
1092029877 12:5275276-5275298 CTGTGCCACAGGCTGGAGCAGGG - Intergenic
1092125680 12:6073675-6073697 CTCTGGCAGGTCCTGGCGCAAGG + Exonic
1093925545 12:24904761-24904783 CTGGGCTAGTTGCTGGGGGAGGG + Intronic
1094192481 12:27711229-27711251 CTGTGCCAGGGGCTGTGGACGGG - Intronic
1094511661 12:31100932-31100954 CTGTGCTGGATGATGGGGCAGGG + Intronic
1095397744 12:41779901-41779923 CTGTGCCAGGCACTGCGTCACGG - Intergenic
1095563077 12:43588561-43588583 CTGTTTCAGGTCCTGGGGTAGGG + Intergenic
1096217494 12:49806093-49806115 ATGTGCCAGGCACTGGGACACGG + Intronic
1096411318 12:51378992-51379014 CCGTGCCAGGTCCTGGTGCCAGG + Intronic
1096941600 12:55352394-55352416 CTGTGCCAACTCCTGGGGGAGGG + Intergenic
1097247150 12:57612875-57612897 CTGAGTCTGGAGCTGGGGCAAGG + Intronic
1097333629 12:58358358-58358380 CTGTGCTAGGTGCTGGAGGGCGG + Intergenic
1098701430 12:73632760-73632782 CTCTGCCAGCAGCTGGGTCAAGG - Intergenic
1099746555 12:86711340-86711362 CAGTACCAGGAGCTGGGGAAGGG + Intronic
1099954794 12:89343301-89343323 CTCTGCCAGGGGCCGGGGCTGGG - Intergenic
1102219701 12:111186283-111186305 CTGAGCCAGGTGCTGGGAATAGG + Intronic
1102247223 12:111362996-111363018 CTGGGGCTGGGGCTGGGGCAGGG + Exonic
1102462267 12:113107198-113107220 CTGGGCCAGCAGCTGGGCCAAGG - Exonic
1102483632 12:113241370-113241392 CAGATCCAGGTGCTGGGGCGTGG + Intronic
1102729109 12:115092324-115092346 CCATGGCAGGTGCTAGGGCAGGG + Intergenic
1102751495 12:115298544-115298566 GTGTGCCAGGTGCTGAGCTAAGG - Intergenic
1102977486 12:117217003-117217025 CTGTGGCAGGGACTGGGGCGGGG + Intronic
1103170701 12:118816993-118817015 CTGTGCCAGTTCCTGGGCCCAGG + Intergenic
1103459128 12:121089878-121089900 CTGTGACAGGAGCTGGGGACGGG - Intergenic
1103568814 12:121830760-121830782 CAGGGCCAGGTGCTGTGGGAAGG + Exonic
1103701932 12:122852633-122852655 CTGTTACAGGTCCTGAGGCAGGG - Intronic
1103704316 12:122863031-122863053 CCTGGCCAGGTGCTGGGGCGGGG + Intergenic
1103722726 12:122983199-122983221 CAGAGCCAGGTGCTGGGGCTGGG + Intergenic
1103724311 12:122990159-122990181 CTGCGCCCCGTGCTGGGCCAGGG - Intronic
1104776385 12:131392468-131392490 CTGTCTCAGGTGCCAGGGCATGG + Intergenic
1104795530 12:131514547-131514569 ATGTGCTTGGTGCTGGGCCATGG - Intergenic
1104847389 12:131853286-131853308 CCGTGCTGGGTCCTGGGGCAGGG + Intergenic
1104886143 12:132109757-132109779 GGGTGCCAGGGGCTGGGGGAGGG - Intronic
1104908663 12:132229061-132229083 CTGTGCCAGTGCATGGGGCAGGG + Intronic
1105303057 13:19152258-19152280 CTTTTGCAGGTGCGGGGGCAGGG + Intergenic
1105607033 13:21934475-21934497 CCGTGCCAGGCCCTGAGGCAAGG - Intergenic
1105702657 13:22944570-22944592 CTGTGCCTGGTGGTGCGGCGGGG - Intergenic
1105746718 13:23383897-23383919 CTGTGCCAGGCACTGGGGTTGGG - Intronic
1105810802 13:23993598-23993620 CTGTGGGAAGGGCTGGGGCATGG - Intronic
1105859423 13:24395611-24395633 CTGAGCCTGGGCCTGGGGCAGGG - Intergenic
1106111210 13:26778881-26778903 GTTTGCCAGGGTCTGGGGCAAGG - Intergenic
1106196993 13:27502455-27502477 CTGTGCCAGGTACTTGGGCTGGG + Intergenic
1106421483 13:29589539-29589561 CTGTGCCAGGTGCCTGGACTTGG + Intronic
1107457150 13:40565404-40565426 CTGAGACAGAAGCTGGGGCATGG - Intronic
1109500932 13:63235536-63235558 CTGTTGCAGGTTCTTGGGCAAGG + Intergenic
1111008091 13:82276090-82276112 CTGTGCCCTGAGCTCGGGCAGGG + Intergenic
1111372432 13:87335182-87335204 CTGTTGCAGGTTCTCGGGCAGGG + Intergenic
1111664488 13:91249847-91249869 CTGTGCCAGGGGCTGGTGCTGGG - Intergenic
1111686812 13:91512527-91512549 CTTTGCCAAGTGCAGGGACATGG - Intronic
1111868494 13:93799820-93799842 CTGGGGCAGGTAGTGGGGCAGGG + Intronic
1112343703 13:98573590-98573612 ATGTGCCAGGTCCTAGGGGAGGG - Intronic
1112441854 13:99430138-99430160 GGGTGCCAGGGGCTGGGGGAGGG - Intergenic
1112489409 13:99848361-99848383 CTGCACCAGGTGCTGGGGACAGG - Intronic
1112739451 13:102456743-102456765 CTGTGCCTAGTGCTGTGGCTGGG - Intergenic
1113766832 13:112887317-112887339 GTGTGCCAGGTGCAGGGCCCTGG + Intergenic
1113784253 13:112994170-112994192 CTGTGCCAGTGTCTCGGGCAGGG + Intronic
1113784301 13:112994404-112994426 CTGTGCCAGTGTCTCGGGCAGGG + Intronic
1113844758 13:113380513-113380535 GGGTGCTAGGTGCTGGGGAAGGG - Intergenic
1113896291 13:113766420-113766442 CTGTCCCAGGTCCTGGGGATTGG - Intronic
1114265587 14:21070917-21070939 CTGGGCCGGGTCCCGGGGCATGG + Intronic
1114499195 14:23155417-23155439 CTGCGCCAGCTGCTGGAGCTGGG + Intronic
1115416299 14:33138524-33138546 CTGAGCATGATGCTGGGGCATGG - Intronic
1115698583 14:35925868-35925890 CTGTGGCAGATGGTGGGGCTAGG + Intronic
1116056434 14:39870067-39870089 GTTTGCCAGGGGGTGGGGCAAGG - Intergenic
1116433240 14:44870123-44870145 CTGTACCAGGTGCTGGGTTCTGG + Intergenic
1117180541 14:53186943-53186965 CTATGACAGGTGCTGAGCCAAGG + Intergenic
1118316053 14:64726762-64726784 CTGTACCAGGTGCTGGGGTGGGG + Intronic
1119442194 14:74636015-74636037 CTGTCCCAGGTGCTGTGCTAGGG + Intergenic
1119617466 14:76108141-76108163 CTGAGCCAGCTGCAGGGGCAGGG + Intergenic
1119621073 14:76132287-76132309 CTGTGCTAAGTGCTGTGCCAAGG + Intergenic
1119702629 14:76765591-76765613 CTGTGCCAGCTCCAGTGGCATGG - Intronic
1119737946 14:76995824-76995846 CTGTTCCAGGTGGTGTGGTAAGG - Intergenic
1119880920 14:78098906-78098928 CTGTTCTTGGTGCTGAGGCAGGG - Intergenic
1120912680 14:89681948-89681970 CTGGGCTAGGTACTGGGGGATGG + Intergenic
1121059400 14:90891182-90891204 CTGTGCCAGGCCCTGGGGTAGGG - Intronic
1121252966 14:92513538-92513560 CTGTGGCTGGGGCTGGGGCGCGG - Intergenic
1121449092 14:93996468-93996490 CTGTGGCTGGAGTTGGGGCACGG - Intergenic
1121449471 14:93998252-93998274 CTGGGGCTGGGGCTGGGGCAGGG - Intergenic
1121456553 14:94042414-94042436 CTGTGCCAGGCACTGGGGCACGG - Intronic
1121789873 14:96690937-96690959 CTATGCCAAGTGCTGGGACGTGG + Intergenic
1121845430 14:97168384-97168406 CTCTGCTAGGTGCTGGGACATGG - Intergenic
1121988914 14:98535751-98535773 CTGTGCCATGTACTGAGCCAGGG - Intergenic
1122234626 14:100324693-100324715 CTGTGCCTGGCCCTGGGTCATGG + Intronic
1122744848 14:103891550-103891572 CTGTGGCAGGAGCTGAGGCTGGG - Intergenic
1122950565 14:105042270-105042292 CAGTTCCAGGGGCTGGCGCAGGG - Intergenic
1123033139 14:105460532-105460554 CTGGGGCAGGTGCTGGGCCCTGG - Intronic
1123086935 14:105721121-105721143 CTGGCCCCGGTGCTGGGGCCAGG + Intergenic
1123402945 15:20004523-20004545 CTGTGGCAGCTGTTGGGACAGGG + Intergenic
1123443691 15:20306801-20306823 CTGGGCCAGGGGCAGGGCCAGGG - Intergenic
1123476734 15:20596260-20596282 CTGGGCCACGTGGTGGGGCTGGG + Intergenic
1123509735 15:20985037-20985059 ATGTGCTAGGTGTTGGGCCAAGG - Intergenic
1123512285 15:21011177-21011199 CTGTGGCAGCTGTTGGGACAGGG + Intergenic
1123566955 15:21558776-21558798 ATGTGCTAGGTGTTGGGCCAAGG - Intergenic
1123603219 15:21996069-21996091 ATGTGCTAGGTGTTGGGCCAAGG - Intergenic
1123641277 15:22404104-22404126 CTGGGCCACGTGGTGGGGCTGGG - Intergenic
1123709877 15:22979931-22979953 CTGTGCCATGTGCCGGGGCGCGG + Intronic
1124134379 15:27021332-27021354 CAGTGCCAGATGCTGTGGGAAGG + Intronic
1125008130 15:34840657-34840679 CTGGGCCAGGTCCTGTGTCAGGG + Intergenic
1125594038 15:40873253-40873275 CTGAGCCTGGGGTTGGGGCACGG + Exonic
1125606803 15:40944060-40944082 CAGTGGCAGGTGTTGGGGCAAGG + Intergenic
1125972828 15:43926025-43926047 CTGTGCTAAGTTCTGGGGGAAGG - Intronic
1126923052 15:53549149-53549171 CTGTCCAAGGTGCTGGGGAGAGG + Intronic
1127070266 15:55282024-55282046 CTGTGCCAGCTGCTGGTTAAAGG - Intronic
1127155886 15:56123898-56123920 CCGTGGCAGGTGCTGGGAGATGG + Intronic
1128144795 15:65327086-65327108 TTGTGTCAGGTCCTGGGGGAGGG - Intergenic
1128358341 15:66943679-66943701 GTGTGTCAGGGGCAGGGGCAGGG + Intergenic
1128509694 15:68305821-68305843 GTGTGCTAGGTGCTGGCGCTGGG - Intronic
1128572259 15:68742374-68742396 CTGTGCAAGCTGCTGGAGGAAGG - Intergenic
1129113197 15:73350268-73350290 CGGTGCCAGGAGGAGGGGCATGG - Intronic
1129608163 15:77034890-77034912 CTAAGCCTGGTGCAGGGGCAGGG + Intronic
1129617357 15:77109430-77109452 CTGTGACAGATGCTGTGGGAGGG - Exonic
1129666376 15:77581862-77581884 CTGGGCCAGGGCCTGGGGCTGGG - Intergenic
1129868753 15:78927875-78927897 ATGTGCCAGGGCCTGGGGGATGG + Intronic
1130059480 15:80559334-80559356 CTGTGGCCGGGGCTGGGGCTGGG - Intronic
1130616693 15:85416242-85416264 CTGTGCCAGGTTCTTGGGGAAGG + Intronic
1130766263 15:86874560-86874582 ATTTCCCAGGTGCTGTGGCAGGG - Intronic
1130927888 15:88398687-88398709 CAAGGCCAGGTGCTGGGCCAGGG + Intergenic
1130948253 15:88565742-88565764 CTGGGCCAGGTCTTGGGGCTTGG - Intergenic
1131072225 15:89473052-89473074 CTGTCCTGGGTGCTGAGGCATGG + Intronic
1131077000 15:89501626-89501648 CTGTTTCAGGTGCTGAGACATGG + Intergenic
1131097913 15:89667497-89667519 CTGCCCCAGATGCAGGGGCACGG - Intronic
1131160493 15:90102076-90102098 CCGTGCCAGGCGCTGGGGTGGGG - Intronic
1132281207 15:100617476-100617498 CAGAGCAAGGTGATGGGGCAGGG - Intronic
1132399786 15:101498300-101498322 CTCTGCCTGGAGCTGGGGGAGGG - Intronic
1132452435 15:101975765-101975787 CAGTGCCCGGTGCTGGGTCAGGG + Intergenic
1202975316 15_KI270727v1_random:285870-285892 ATGTGCTAGGTGTTGGGCCAAGG - Intergenic
1132637481 16:959395-959417 GCGTGCCAGGGGCTGGTGCAGGG + Intronic
1132691050 16:1182113-1182135 CTGTGGCAGGGGCAGGAGCAGGG + Intronic
1132937217 16:2487195-2487217 CTGTGCCTGCTGCTGTGGAAGGG - Intronic
1133021179 16:2967603-2967625 CGGTGCGGGGCGCTGGGGCAGGG + Exonic
1133171976 16:3987274-3987296 CTGTTCTTGGTGCTGGGGAAGGG - Intronic
1133217108 16:4299314-4299336 GGGTGCCGGGTGCTGGGGCTGGG - Intergenic
1133278944 16:4654318-4654340 CTGTGTCAGGAACTGGGGCTGGG + Intronic
1134015181 16:10883213-10883235 CTGACCCTGGTGCTGGGGTAGGG - Intronic
1134049793 16:11129601-11129623 CAGTGCAAGGCCCTGGGGCAGGG - Intronic
1134058460 16:11184524-11184546 CTGTGGCAGGTGCTAGGACCTGG - Intergenic
1134079363 16:11314448-11314470 CTGTTCCAGGCCCTGGGGCTAGG + Intronic
1134098618 16:11436062-11436084 CTGGGCCAGGAGCTGGAGCCAGG - Intronic
1134816117 16:17207437-17207459 CTGTACCAGGTCCAGGGGCAAGG - Intronic
1135423760 16:22322264-22322286 CTGTGGCTGGAGCTGGGTCAGGG + Intronic
1135617988 16:23928582-23928604 CTGAGCTAGGAGCTGGGGTAAGG + Intronic
1135845075 16:25911444-25911466 CTCTGCCAGATGCTGGGGAATGG - Intronic
1135876078 16:26201231-26201253 CTGTGCTGGGTCCTGGGGAATGG - Intergenic
1136011682 16:27367580-27367602 CAGTGCCAGATGCTGGGGCGGGG - Intergenic
1136072771 16:27798283-27798305 CTCTGCCAGGAGCTGGGGAGGGG + Intronic
1136107557 16:28040933-28040955 CTGTGCCAAGTGCTAGGGTGAGG + Intronic
1136268117 16:29132540-29132562 CTGTGCCTTCTGCTGGGGCAGGG + Intergenic
1136448744 16:30340201-30340223 CTGGCCCAGGTGCAGGGGCATGG - Intergenic
1137432170 16:48427230-48427252 CAGTCCCAGGGGCAGGGGCAGGG + Intronic
1137720205 16:50623255-50623277 CTGTGCAGGATGGTGGGGCATGG - Intronic
1137928175 16:52561818-52561840 CTGTTCCAGGTGTGAGGGCAGGG + Intergenic
1138348185 16:56332601-56332623 CTGTTCCAGGAGCTGGGGATGGG - Intronic
1138451531 16:57096007-57096029 CTGTTCTAAGTGCTGGGACATGG - Intronic
1138519626 16:57563585-57563607 CTGGGGCTGGTGCTGGGGCTGGG + Intronic
1138615748 16:58164681-58164703 CTGTGCCAGACACTGGGGCGGGG + Intronic
1139373214 16:66480889-66480911 CTGGGCCAGAGGCTGGGGCCCGG - Exonic
1139477404 16:67209634-67209656 CTGAGGAAGGTGCTGGGGCGGGG - Intronic
1139702125 16:68714291-68714313 CTGTGCTTGGTGCTGGGGTGAGG - Intronic
1140041649 16:71412294-71412316 CTGTGCCAGGTGCAGGGTCAAGG - Intergenic
1141346686 16:83253034-83253056 CTGTGCCAGGTGCTGTGCTAAGG - Intronic
1141427472 16:83953380-83953402 CGGGGCCAGGTTCCGGGGCAGGG + Intronic
1141594012 16:85086576-85086598 CAGGGCGAGGAGCTGGGGCAAGG + Intronic
1141623864 16:85251334-85251356 TTGTGCTGGGTGCTGGGACACGG - Intergenic
1141957530 16:87383065-87383087 CCGTGCCGGGAGCTGGGGCTGGG - Intronic
1142067113 16:88068981-88069003 CTGGGCTGGGTGCAGGGGCAGGG - Intronic
1142071427 16:88092878-88092900 CTGTGCCTTCTGCTGGGGCAGGG + Intronic
1142291718 16:89196273-89196295 CTGGGCCTGGTGCTGGGGGCCGG - Exonic
1142291750 16:89196354-89196376 CTGGGCCTGGTGCTGGGGGCCGG - Intronic
1142291782 16:89196435-89196457 CTGGGCCTGGTGCTGGGGGCCGG - Intronic
1142409962 16:89910963-89910985 CAGGGTCCGGTGCTGGGGCAAGG + Intronic
1142488291 17:260819-260841 CTGTGCCTGGTGATGGGGGTGGG - Intronic
1142746338 17:1960713-1960735 GTTTGCCAGGGGCTGGGGGAGGG - Intronic
1142967460 17:3590443-3590465 CCGGGACAGGTGCTGGGGAAGGG + Intronic
1143256274 17:5560290-5560312 CTGTGCCAGGTGCTGCTATAGGG + Intronic
1144328739 17:14206072-14206094 TTGTGCCAGGCTCTGGGGGATGG + Intronic
1144374788 17:14628248-14628270 CGGTGTCAGGTGTTGGTGCACGG - Intergenic
1144722034 17:17477656-17477678 CTGTGCCAAGTGCTACGGGATGG + Intronic
1144949713 17:18987370-18987392 CTGTGACAGGGCCTGGCGCACGG + Intronic
1145005686 17:19336467-19336489 CTGTGCCAGAAGATGGGGCAGGG - Exonic
1145306317 17:21677244-21677266 CTGCGGCTGGTGCTGGGGCTGGG - Intergenic
1145782465 17:27572010-27572032 CTCTGCCAGCTGCTGGGGGAGGG + Intronic
1146003352 17:29145195-29145217 GTGTGCCTAGTGCTGGGGAACGG - Intronic
1146188461 17:30743704-30743726 ATGTGCTAGGTACTGTGGCAGGG + Intergenic
1146333335 17:31948020-31948042 ATGTGCTAGGTACTGTGGCAGGG + Intronic
1146520457 17:33521900-33521922 AGGTGCCAGGTGATGGGGGAAGG - Intronic
1146666888 17:34711173-34711195 CTCATGCAGGTGCTGGGGCAGGG - Intergenic
1147155115 17:38540701-38540723 ATCTGCCAGGGGCCGGGGCAGGG + Intronic
1147258210 17:39194655-39194677 GGGTGCCTGGTGCTGGGGGAGGG + Intronic
1147311523 17:39598755-39598777 CGGTGCCAGGCGCGGGGGGAAGG - Intergenic
1147378073 17:40034862-40034884 CTGTGCTAGGTGCTGGGGGTGGG - Intronic
1147744750 17:42688271-42688293 CTGTGGCAGTTGCTGGGTCATGG + Intronic
1147854064 17:43465314-43465336 CAGCGCCTGGTGCTGGGGCTGGG + Intergenic
1147874328 17:43610303-43610325 CTGTGCAAGCTGCTGGAGGACGG - Intergenic
1147924829 17:43939910-43939932 CTGTGCAAGGTGCTGAGCCCAGG + Intergenic
1147951073 17:44108379-44108401 CTGTGCTAGGTGCTGGGCAATGG + Intronic
1147961150 17:44168407-44168429 CTGGGCAAGGTGCTGCTGCAGGG + Intergenic
1148073094 17:44920043-44920065 CTGTGCCAGGCACTGGGCCAGGG - Intergenic
1148150483 17:45394099-45394121 CTGTGCCAGGTGCTGTGCTCTGG - Exonic
1148155729 17:45424483-45424505 CAGTGCCAGGCCCTGGGGAATGG - Intronic
1148186840 17:45650543-45650565 CTGTGCCAGGCGCTGGGGAGGGG + Intergenic
1148382391 17:47209488-47209510 CTGGGGCAGGGGCTGGTGCAGGG - Exonic
1148674617 17:49438262-49438284 CTTTGTGAGGTGCTGGTGCAGGG + Intronic
1148863041 17:50614463-50614485 CTCTTCCAGGTGCTGAGGAAGGG - Intronic
1149353374 17:55814477-55814499 CTGTGCCAGCAGCTGTGCCAAGG + Intronic
1149664763 17:58357897-58357919 CTGGGCCAGGGGCTGGCTCAGGG + Exonic
1149814774 17:59713091-59713113 TTGTGCCAGGTACTGGGAGAAGG + Intronic
1150072527 17:62163960-62163982 CTGTGGTAGGTGAAGGGGCAAGG - Intergenic
1150387419 17:64773147-64773169 CAGTGCCAGGCCCTGGGGAATGG - Intergenic
1150844414 17:68640794-68640816 CTATGCTAAGTGGTGGGGCATGG - Intergenic
1151604662 17:75128902-75128924 CTGTGCCAGGTTCCGGAGCCTGG - Exonic
1151821052 17:76497157-76497179 CTGTGCCAGCAGGTGGTGCAGGG - Intronic
1152042688 17:77914842-77914864 CTGCGCCAGGTGCTGGGCTGAGG - Intergenic
1152250944 17:79212259-79212281 CTGGGGCTGGGGCTGGGGCAGGG + Intronic
1152456425 17:80419379-80419401 CTGTGCCAGATGCTGAGCCATGG + Intronic
1152471516 17:80492343-80492365 GTGGGGCAGGTGGTGGGGCAGGG + Intergenic
1152659629 17:81536279-81536301 GCCTGCCAGGTACTGGGGCAGGG + Intronic
1152683264 17:81680976-81680998 CTGTGGCAGATGCAGGGTCAGGG + Intergenic
1152701983 17:81823847-81823869 GTGTGCCGTGTGCTGGGGCCGGG - Intronic
1152876613 17:82790079-82790101 CAGAGCCACGTGCTGGGACAAGG - Intronic
1153496086 18:5701592-5701614 TTGTCCCAAGTGGTGGGGCAAGG + Intergenic
1153782327 18:8505436-8505458 CTGGGCCAGGTGCTGGGAGGGGG + Intergenic
1154331828 18:13436242-13436264 CTGTGCTAGGTACTGAGACATGG - Intronic
1155032526 18:21996931-21996953 CTGTGACAGGTGATTGGGAAAGG + Intergenic
1156833560 18:41525253-41525275 CTTTGGCAGGGGCTGAGGCAGGG + Intergenic
1157384038 18:47247426-47247448 CTGTGGCAGCTGCCGGGGCAGGG - Intronic
1157392420 18:47313936-47313958 CTGTGCCAGGGGCTGGATGATGG - Intergenic
1157606829 18:48931143-48931165 GGGTGCCAAGTGCTGGGGGAGGG + Intronic
1157700683 18:49760028-49760050 CTGTGCAAGGTCAGGGGGCAGGG + Intergenic
1157763185 18:50280116-50280138 CTGTGGCAGGTCCTAGGGCTTGG - Intronic
1157936915 18:51883574-51883596 CACTGCCAGGGGCTGGGGGAGGG - Intergenic
1160454732 18:78992593-78992615 CTGTTCCAGGATCAGGGGCACGG - Exonic
1160536437 18:79597016-79597038 CTGGGCGAGGTGCTGGAGCCGGG - Intergenic
1160578210 18:79869043-79869065 CTGTCCCAGGTGCAGGGGTGGGG + Intronic
1160723438 19:607432-607454 CTGTGCCAGGCTCTGGGGAGGGG - Intronic
1160923000 19:1529352-1529374 CTGTCCCTGGGGCTGGGGCCGGG + Intronic
1160947546 19:1650745-1650767 CTGTGCCATCTGCTGGGGGAGGG - Intronic
1161113636 19:2484357-2484379 ATCTGCCAGGTGCTGGGTCCTGG + Intergenic
1161219145 19:3110047-3110069 CTGTGCTGGGTGCTGCAGCACGG + Intronic
1161311330 19:3595737-3595759 CTGGGCCGGGTGCTGAGGCGAGG + Exonic
1161441222 19:4292690-4292712 CCGGGCCTGGGGCTGGGGCAGGG + Exonic
1161609329 19:5232279-5232301 ATGTGCCAGGTACTGTGCCAAGG + Intronic
1161758254 19:6150674-6150696 AGGTGCCAGGGGCTGGGGAAGGG + Intronic
1161865292 19:6828611-6828633 CTGAGCCAGGTCCTGGGGAGGGG - Exonic
1161991405 19:7686257-7686279 CTGGGCCCGGGGTTGGGGCAAGG + Exonic
1162000003 19:7738190-7738212 GGGTGCCAGGGGCTGGGGAACGG + Intergenic
1162063133 19:8108938-8108960 CTGTGTCATGTGCTGGGGACTGG - Intronic
1162397350 19:10424710-10424732 GTGTGGCAGGGGCTGGCGCATGG - Intronic
1162470001 19:10867145-10867167 GGGTGCCAGGGGCTGGGGGAGGG - Intronic
1162521339 19:11181587-11181609 GGGTGCCAGGGGCTGGGGGAAGG + Intronic
1162771023 19:12949365-12949387 CTGGCCCAGCTGCTGGAGCAGGG - Exonic
1163313824 19:16529672-16529694 CAGGGGCAGGTGCTGGGGCCGGG + Exonic
1163366229 19:16877534-16877556 CCGAGCCAGGTGCTGGGGACAGG - Exonic
1164447609 19:28331332-28331354 CTGGCCAAGGTGCTGGGGCAGGG + Intergenic
1164671232 19:30073274-30073296 CCGTGCCTGGTGCTGGGATATGG - Intergenic
1164726243 19:30467847-30467869 CTGCTCCAGGTGCTGTGGAAAGG - Intronic
1164826699 19:31289530-31289552 CTTTACCAGGGGCTGGGGCCCGG - Intronic
1165005335 19:32800956-32800978 AGGAGCCAGGTGCGGGGGCAGGG + Intronic
1165129543 19:33623079-33623101 CAGTGCCCGATGCTGGGGCTTGG + Intronic
1165351394 19:35277773-35277795 CGGTGCCTGGTGCTGGGGCTTGG + Intronic
1165351701 19:35279307-35279329 CTGTGCTAAGGGCTGGGGAAGGG - Exonic
1165476830 19:36035487-36035509 CTGTGGCAGGTGCAGGGTCCTGG + Exonic
1165708548 19:37993268-37993290 CTGTGCCAAGAGCTGGTTCAAGG - Intronic
1165737507 19:38185988-38186010 CTGGGACAGGTGCTGGGGGTGGG - Intronic
1165842162 19:38794940-38794962 GATTGCCAGGTGCTGGGGGAGGG - Intergenic
1167052723 19:47089601-47089623 CTTTGTCAGGTGATGGGGCTGGG + Intronic
1167071705 19:47226066-47226088 CCGTGCCAGGGGCTGGGGGGCGG + Intronic
1167482908 19:49744217-49744239 CTGTGCCAGGTAACGGGGCTGGG - Exonic
1167490439 19:49789928-49789950 CTGTGCTAGGAGCTGGGTTATGG + Intronic
1167570130 19:50281685-50281707 TTCTGCCAGGCGCTGGGTCAGGG - Exonic
1167893859 19:52564936-52564958 ATGAGCCAGGCGCTGTGGCAGGG + Intronic
1168022515 19:53619962-53619984 CTGTGACAGGGGATGAGGCAGGG - Intergenic
1168228986 19:55016719-55016741 CTCAGCCATGTGCTGGGCCATGG + Intronic
1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG + Intronic
1168470175 19:56633482-56633504 CTGTGCCAGGCACTGTTGCAGGG + Intergenic
1168713693 19:58515398-58515420 CTGAGCCAGGTGCCTGGGCCAGG - Intronic
925340709 2:3133579-3133601 GGGTGCCAGGGGCTGGGGGAGGG + Intergenic
925362623 2:3289990-3290012 CTTAGCCAGGAGCTGTGGCAGGG - Intronic
925390740 2:3492246-3492268 CTGGGCCAGGCGCTGGCGAAGGG - Intergenic
925911009 2:8573649-8573671 CTGTGCAAGGTGGTGGGGGAAGG + Intergenic
925918760 2:8625279-8625301 CTGTGGCAGGTGGTTGGGGAGGG + Intergenic
925924266 2:8659188-8659210 CTGCCCCAGGGGCAGGGGCAGGG + Intergenic
925950006 2:8901054-8901076 CTGTTGCAGGTTCTTGGGCAGGG - Intronic
925950031 2:8901213-8901235 CTGTTGCAGGTTCTTGGGCAGGG - Intronic
926054834 2:9768464-9768486 CAAGGCCAGGTGTTGGGGCAGGG - Intergenic
926143771 2:10384491-10384513 CTGTGCTGGGCACTGGGGCAAGG + Intronic
927475452 2:23411085-23411107 CTGTGCCAGGCACAGTGGCATGG + Intronic
927515726 2:23670565-23670587 CTGTGCCAGGGCCTGCGGCGGGG + Intronic
927576836 2:24207654-24207676 CAGTGCAGGGAGCTGGGGCAGGG + Intronic
927616057 2:24597492-24597514 TTGTGGCAGGGGCTGGGGCTGGG + Intronic
928126017 2:28617059-28617081 ATTTTCCAGGTGCTGGGGAAAGG - Intronic
929060823 2:37923142-37923164 CTTTGCCAGGTACTGTTGCAGGG - Intergenic
929125254 2:38517758-38517780 CAGTCTCAGGTGCTGGGTCAGGG + Intergenic
929525905 2:42702768-42702790 CTGTGCAGTGTTCTGGGGCACGG + Intronic
929545085 2:42850527-42850549 CTGGGCCAGGGGCTGGAGCTGGG - Intergenic
929578488 2:43067659-43067681 CTGGCCCAGGTGTTGGGGGAGGG - Intergenic
929788660 2:45009040-45009062 GTGTGCGAGGTGCTGCAGCAGGG - Exonic
929853659 2:45616519-45616541 GTTTGCCAGGTGCTGGTGGAAGG - Intergenic
930028021 2:47041303-47041325 CTGTGCCAGACGCTGGGGGAGGG + Intronic
930866064 2:56123219-56123241 CTTGGCCAAGAGCTGGGGCAAGG - Intergenic
931145874 2:59517638-59517660 CTGTGCATGTTGGTGGGGCAGGG + Intergenic
931359372 2:61565127-61565149 TTGTCCCAGCTCCTGGGGCAGGG - Intergenic
931458431 2:62430534-62430556 TGGTGCCAGGGGCTGGGGCAGGG + Intergenic
932544064 2:72688528-72688550 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
932584833 2:73021167-73021189 CTGTGCCGGGTGCAGGGACTGGG + Intronic
932623944 2:73283895-73283917 CTGAGCCAGGTTTTGGGGCGGGG - Intronic
932779446 2:74550664-74550686 GTGTGCCAGGTGCTCTGCCATGG + Intronic
933610494 2:84429494-84429516 CTGTGCCAGGGGACTGGGCAGGG + Intronic
934039133 2:88113190-88113212 CTGTGCAAGGTTCTGGGGATAGG - Exonic
934187762 2:89762291-89762313 GGGTGTCAGGGGCTGGGGCAGGG - Intergenic
934308855 2:91845657-91845679 GGGTGTCAGGGGCTGGGGCAGGG + Intergenic
934709117 2:96503666-96503688 CTGTGCCTGGGTCTGGAGCAGGG + Intronic
934769586 2:96899360-96899382 CTGTGCCAGGTACTGGCACTGGG - Intronic
935328819 2:101961689-101961711 CTGTGCCATTTGCTGGTGCTGGG + Intergenic
936089935 2:109495000-109495022 GCCTGCCAGCTGCTGGGGCAGGG - Intronic
936142008 2:109948593-109948615 CTGTGCCAGGCACTGTGCCAGGG - Intergenic
936152197 2:110027966-110027988 CTGCTCCAGGGCCTGGGGCAGGG + Intergenic
936178696 2:110246541-110246563 CTGTGCCAGGCACTGTGCCAGGG - Intergenic
936192481 2:110343447-110343469 CTGCTCCAGGGCCTGGGGCAGGG - Intergenic
936202682 2:110422891-110422913 CTGTGCCAGGCACTGTGCCAGGG + Intronic
936245159 2:110820157-110820179 CTGTGCCTGGTGCTGTAACAAGG + Intronic
936568647 2:113598239-113598261 CAGTGCCCAGTGCTGGGTCAGGG + Intergenic
937060395 2:118976522-118976544 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
937082412 2:119149875-119149897 CTGTGCCTGATGGTGGGGGAAGG - Intergenic
937436645 2:121886987-121887009 CTGTGTCAGGAACTGGGGCCAGG + Intergenic
937512387 2:122611035-122611057 TTCTGCCAGGGGATGGGGCAGGG - Intergenic
937659579 2:124415115-124415137 CTGTGCCAGATGCTAGTGCTGGG + Intronic
937779259 2:125818753-125818775 CTTAGCCAGGCCCTGGGGCAAGG + Intergenic
937876383 2:126828632-126828654 GGCTGCCAGGGGCTGGGGCAAGG + Intergenic
937904215 2:127044993-127045015 CTGAGCCAGTTGCTGTGGCCTGG - Intergenic
937986583 2:127640778-127640800 CTCTGCCAGGTGCTGAGCCCAGG - Intronic
938249035 2:129799445-129799467 CTCTACCTGGGGCTGGGGCATGG + Intergenic
939536225 2:143432934-143432956 CCGTGACAGATGCTGGGGTAAGG - Intronic
940010027 2:149042627-149042649 CTGTTCTAGGTGCTGGGGATTGG + Intronic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
942520089 2:176794676-176794698 ATGTGATAGGGGCTGGGGCAGGG - Intergenic
943103188 2:183511287-183511309 CTGTTGCAGGTCCTTGGGCAGGG - Intergenic
943149109 2:184087775-184087797 CTGTGCCAGTTGCTGAGACTAGG - Intergenic
943237344 2:185338904-185338926 CACTGCCAGTGGCTGGGGCAGGG + Intergenic
943972414 2:194428081-194428103 ACCTTCCAGGTGCTGGGGCAGGG + Intergenic
944904977 2:204253085-204253107 AGGTGCCAGGGTCTGGGGCAGGG - Intergenic
945158646 2:206865403-206865425 ATGTGCAAGGTGCAGGAGCATGG + Intergenic
945520383 2:210820174-210820196 CTGTGTCAGGTGCTATGCCATGG - Intergenic
946159034 2:217824920-217824942 GTGTGCCAGGTGCTGTGTGAGGG - Intronic
946322272 2:218960949-218960971 GTGTGTCAGGGGCTGGGGCGGGG - Exonic
946758761 2:222972628-222972650 CTGGGGCAGGTGAAGGGGCAGGG + Intergenic
947114903 2:226759090-226759112 CTGTGTCCGGGGCTGGTGCAAGG + Intronic
947138001 2:226994246-226994268 CTGTCCCAGATGCTGGGGAGAGG + Intronic
947497898 2:230651990-230652012 TGGTGCCAGGGGCTGGGGGAGGG - Intergenic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947626533 2:231622668-231622690 CTGGGCCTGGAGCTGGGGCTGGG - Intergenic
947636105 2:231681358-231681380 CTGTGCCTGGCGTTGGGGCCCGG - Intergenic
947744622 2:232501224-232501246 ATGTGCCAGGGGCAGGGGGAAGG - Intergenic
948133012 2:235614667-235614689 GTGTGCCAGGCTCAGGGGCAGGG + Intronic
948370678 2:237487389-237487411 CTCTCCCAGGTGCTGGACCAGGG + Exonic
948493291 2:238327746-238327768 GGGTGCCAGGGGCTGGGGTACGG - Intronic
948575536 2:238947185-238947207 CTGTGCCTGGGGCAGGGGCGGGG + Intergenic
948599049 2:239097631-239097653 CTTTGGGAGGTGCTGGGGCTGGG + Intronic
948854305 2:240722921-240722943 ACGCGCCAGGTTCTGGGGCAGGG + Intronic
949037967 2:241827130-241827152 CTCAGCGAGGTGCTGGGGTAGGG - Intergenic
1168827219 20:822002-822024 ATGTGCCAGGTGCTGCAGTAGGG - Intergenic
1169161384 20:3381962-3381984 CTGTACTAGATGCTGGGGTATGG + Intronic
1171354304 20:24532442-24532464 GTTTGCCAGGGGCTGGGGAAAGG + Intronic
1171387175 20:24778336-24778358 GTGTGCAAGGTTCTGGGGCAGGG + Intergenic
1171400709 20:24871681-24871703 CTGTGCCTGGGGCAGGAGCAGGG - Intergenic
1171448257 20:25219572-25219594 CTGCTTCAGGGGCTGGGGCACGG + Intronic
1171524280 20:25797188-25797210 CTGTGGCTGGGGCTGGGGCTGGG - Intronic
1171532969 20:25864204-25864226 CTGTTGCTGGTGCTGGGGCTGGG - Intronic
1171552547 20:26058695-26058717 CTGTGGCTGGGGCTGGGGCTGGG + Intergenic
1171806936 20:29688915-29688937 CTGTGGCTGGGGCTGGGGCTGGG + Intergenic
1172044934 20:32073632-32073654 CTGTTCCAGGTGCCGGGTGAGGG + Intronic
1172071912 20:32263870-32263892 CTGTGCCAGGTGATGAATCACGG + Intergenic
1172145527 20:32755200-32755222 CTGTGCCAGGCACTGTGGTAAGG - Intergenic
1172245331 20:33442192-33442214 GTGTGCCAGGTGCTGTGCCCAGG - Intronic
1172698937 20:36840897-36840919 CTGTGCTAAGCGCAGGGGCAGGG + Intronic
1172966934 20:38842690-38842712 CTGTGCCTGGGGGTGGGGGAGGG - Intronic
1173250611 20:41362465-41362487 CTGTGACAGCTCCTGGCGCAGGG + Exonic
1173338768 20:42135643-42135665 TTGTGCCAGGTGGTGGGATACGG + Intronic
1173551638 20:43936957-43936979 GTGTGCCAGGCACTGTGGCAGGG + Intronic
1173642570 20:44614240-44614262 CTGTGCCAGTGCCTGGCGCATGG + Intronic
1174255102 20:49248672-49248694 CTGTGGCAGGAGCCTGGGCAAGG + Exonic
1174409334 20:50323411-50323433 GTGTGCCAGATGCTGTGCCAAGG + Intergenic
1175072569 20:56346525-56346547 CTATGCCAGGCGCTGGGTGATGG - Intergenic
1175191379 20:57214306-57214328 CCCTGCAAGCTGCTGGGGCAGGG - Intronic
1175263137 20:57687270-57687292 CTGTGCCTGGGGCTGGTCCAAGG + Intronic
1175368450 20:58471011-58471033 CTGTCCCAGATTCTGGGGCTGGG + Intronic
1175744864 20:61449109-61449131 CAGTGCCAGGGGCTGGGTGAGGG + Intronic
1175969493 20:62677119-62677141 TGGTGCCAGGGGCTGGGGGAAGG + Intronic
1176070272 20:63222599-63222621 CTGGGCCAGGTGCCTGGGGAGGG + Intergenic
1176088926 20:63310372-63310394 CTGTTCCAGGTGGTGGTGGAGGG + Exonic
1176301398 21:5100710-5100732 CGGTCCCAGGGGCTGGGCCAGGG + Intergenic
1176413084 21:6459272-6459294 CTGGGGCAGGCGCTGGGGGAAGG - Intergenic
1176517179 21:7794481-7794503 CTGTGCCAGGTGGTGAGAAATGG + Intergenic
1177939579 21:27392108-27392130 CTGTGCTAGGTGCTGGAGACAGG - Intergenic
1178133768 21:29603033-29603055 GTGTGCCAGTTGGTGGGACAGGG - Intronic
1178651207 21:34424493-34424515 CTGTGCCAGGTGGTGAGAAATGG + Intergenic
1178796406 21:35748547-35748569 ATGTTCCATCTGCTGGGGCACGG - Intronic
1179477001 21:41653362-41653384 TGGTGCCAGGGGCTGGGGGAAGG - Intergenic
1179505527 21:41837518-41837540 GGGTGCCAGGGGCTGGGGGAGGG + Intronic
1179522072 21:41952330-41952352 CTGTGCCTGGTCCTTGTGCATGG - Intronic
1179680860 21:43020396-43020418 CCGTGCCAGGGCCTGGAGCACGG + Intronic
1179688579 21:43067594-43067616 CTGGGGCAGGCGCTGGGGGAAGG - Intronic
1179855633 21:44161189-44161211 CGGTCCCAGGGGCTGGGCCAGGG - Intergenic
1179934376 21:44592882-44592904 CTGTGTCCGGTGATGGGGGAAGG - Intronic
1180071302 21:45436967-45436989 CTGTGGCAGGAGCTGTGGCTGGG + Intronic
1180087914 21:45516319-45516341 CTGTGCCAGGTGGTGGAGGTCGG - Intronic
1180233482 21:46442261-46442283 CTTTGTCAGGTGGTTGGGCATGG + Intronic
1180535938 22:16392745-16392767 GGGTGTCAGGGGCTGGGGCAGGG + Intergenic
1180635360 22:17259107-17259129 GTGTGCCAGGAGCTGGGTGATGG + Intergenic
1181031419 22:20150296-20150318 CTGCGGCTGGGGCTGGGGCAGGG + Intronic
1181031445 22:20150351-20150373 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1181093218 22:20488516-20488538 CTGTGCCAAGTGCTGGGATGGGG + Intronic
1181172329 22:21016689-21016711 TGGTGTGAGGTGCTGGGGCATGG + Intronic
1181306029 22:21917794-21917816 CTGCTGCAGGTGCTGGGGCAAGG - Intergenic
1181479116 22:23186554-23186576 CAGTGCCAGGGGCTGGGGGCAGG - Intronic
1181511912 22:23393100-23393122 CTGGGGCTGGGGCTGGGGCAGGG - Intergenic
1181542732 22:23582405-23582427 GGGTGCCAGGGGCTGGGGGAGGG - Intergenic
1181638698 22:24185942-24185964 CTTTCCCAGGGTCTGGGGCACGG - Intronic
1181764005 22:25078195-25078217 ATGTGCCAGGCACTGGGCCAAGG - Intronic
1181959563 22:26613084-26613106 CTGTGGCAGGTACTGGGGCTGGG - Intronic
1182269796 22:29146108-29146130 CGGTGCCAGGTGGTGGGGTGTGG - Intronic
1182354251 22:29715243-29715265 CCTTGCCAGGTCCTGGAGCAGGG - Intergenic
1182447376 22:30397498-30397520 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1182516022 22:30859555-30859577 CTGTGCTAGGAGTTGGGCCAAGG + Intronic
1182831279 22:33306524-33306546 CTGTGGCAGGTCACGGGGCAGGG - Intronic
1183120562 22:35727139-35727161 CTGTTCCAGCTCCCGGGGCAGGG + Exonic
1183202601 22:36396150-36396172 CTGTACCAGGTGCTGGAACTTGG + Intergenic
1183205981 22:36419257-36419279 CGGAGCCAGGGGCTGGGGCTGGG + Intergenic
1183468169 22:37990548-37990570 CTGGGCCAGGAGCTGGGACTGGG + Intronic
1183541079 22:38429762-38429784 CCCTGCCAGCTGCTGGGGCCTGG - Intronic
1183565960 22:38615608-38615630 CAGTGCCTGGTGCTGTGGGAGGG + Intronic
1184084148 22:42248471-42248493 CTGTGCCTGGTACTGGGTAAGGG + Intronic
1184112526 22:42403711-42403733 CTGTGCTAGAGGCTGGGGCTTGG + Intronic
1184280639 22:43435522-43435544 CTTTGCCAGGCACTGGGGCCTGG - Intronic
1184337600 22:43862844-43862866 CTGTGCCAGGCACTGGGCCAGGG + Intergenic
1184377492 22:44123902-44123924 CTGTGCCAGGCACTGTGCCAGGG - Intronic
1184430241 22:44438194-44438216 CTCGGCCAGGTCCTGGGGCTGGG + Intergenic
1184453271 22:44595277-44595299 CTGGGCCTGGAGCTGGGACAAGG - Intergenic
1184478681 22:44735175-44735197 CTGGGCCTTGGGCTGGGGCAGGG + Intronic
1184519873 22:44986965-44986987 CTCTGCTTGGAGCTGGGGCAGGG - Intronic
1184557605 22:45241406-45241428 CTGTGCCAGGTGCAGAGGAGGGG - Intergenic
1184872474 22:47249646-47249668 CCGTGCTATGTGCTGGGCCAAGG - Intergenic
1184986535 22:48139942-48139964 CTCTGCCTGGTCCTGGGGCCCGG - Intergenic
1185010123 22:48308247-48308269 CTGTGCCAGGCCCTGGGTGAAGG + Intergenic
1185124884 22:49004305-49004327 CTGGGCTAGGTGCTGGGGAGGGG + Intergenic
1185143569 22:49117230-49117252 CTGGAGCAGGTGTTGGGGCAGGG + Intergenic
950100066 3:10351251-10351273 CAGGGCCAGCTGCTGGGGTAGGG - Intronic
950106076 3:10389584-10389606 GGGTGCCAGGGGCTGGGGAAGGG + Intronic
950413851 3:12856870-12856892 CAGGGCCAGGTGCTGGGGGCGGG - Intronic
950442935 3:13020249-13020271 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
950446051 3:13039294-13039316 CTCTGCCAGAGGCTCGGGCAGGG - Intronic
950477284 3:13222145-13222167 AGGTGCCAGGGGCTGGGGGAGGG - Intergenic
950481371 3:13246337-13246359 GGGTTCCAGGGGCTGGGGCAGGG + Intergenic
950532337 3:13559539-13559561 CTGAGTCAGGTGCTGTTGCAAGG + Intronic
950655666 3:14434794-14434816 CCGTGCCAGTTGCAGGGGGAGGG - Intronic
950834265 3:15904080-15904102 CAGTGCCAGGTGCTGGCTGAAGG + Intergenic
951088094 3:18538621-18538643 CTGTGCCAGGTGCTGGCTGCTGG - Intergenic
951279615 3:20732004-20732026 TGCTGCCAGGTGCTGGGGGAGGG + Intergenic
951456031 3:22893354-22893376 CTGTGCCAGGGGCTAAGGCAGGG - Intergenic
951806942 3:26655803-26655825 ATATGCCAGGTACTGGGCCAAGG + Intronic
952833563 3:37585434-37585456 CTGTGCCAGGTTCTTGGGAGAGG - Intronic
952942954 3:38457091-38457113 CTGCGCCAGAGGCTGAGGCAGGG + Intronic
952953627 3:38543364-38543386 CTGTGCCAGGTGCTGGGGCAGGG + Intergenic
952965238 3:38617002-38617024 CTGTGGGAGGGTCTGGGGCAGGG - Intronic
953791616 3:45951862-45951884 CTCTGCCAGGAGGAGGGGCAAGG + Intronic
953793909 3:45968287-45968309 CTGTGCCAAGGGCTGCAGCATGG + Exonic
953960236 3:47260833-47260855 GTTTGCCAGGTGATGGGGAAGGG + Intronic
953980705 3:47411584-47411606 CTGTGCCAGGCAGTGGGGCCTGG - Exonic
954409389 3:50363815-50363837 CAGTGCCAAATGCTGGGGCAGGG - Intronic
954563396 3:51578141-51578163 CTGGACCAGGGGGTGGGGCAGGG - Intronic
954598798 3:51851818-51851840 CTGTTGCAGGTTCTTGGGCAGGG + Intergenic
954609919 3:51938973-51938995 CTGGTCCGGGGGCTGGGGCATGG - Intronic
954786547 3:53097297-53097319 CAGGGCCAGGCGCTGGGGCCAGG + Intronic
955152251 3:56379416-56379438 CTGTGCCAGGCACTGAGCCAAGG + Intronic
955411998 3:58661755-58661777 CTGTGCCAGGTGTTGGGTTTTGG - Intronic
956193054 3:66625368-66625390 CTGAGCTAGGTGCTGGAGAAAGG - Intergenic
956681587 3:71785937-71785959 CTGTGCCTGGAGCTGGCGCGGGG - Intergenic
956702985 3:71975028-71975050 TTGTGCTGGGTGCTGGGGGAAGG + Intergenic
956825854 3:72996644-72996666 CTGGGCCTGGGGCTGGGGCTGGG + Intronic
958703439 3:97622257-97622279 GTTTGCCAGGGGCTGGGGGAAGG - Intronic
959263320 3:104107435-104107457 CTGTGCTATGTGTTGGTGCAAGG - Intergenic
960038643 3:113127133-113127155 CTGTGTCAGCACCTGGGGCATGG - Intergenic
960295769 3:115941777-115941799 GGTTGCCAGGAGCTGGGGCATGG + Intronic
960452801 3:117831182-117831204 CTGTGATAGGTGCTCGGGTAAGG - Intergenic
961339540 3:126208754-126208776 CTGGGCGAGGAGCTGGGACACGG + Intergenic
961484343 3:127206776-127206798 CAGGGCCAGGGGCAGGGGCAGGG + Intergenic
961518935 3:127455905-127455927 CTGTCCCAGGCGCTCGGGCTGGG + Intergenic
961674496 3:128556174-128556196 CTGGGGCAGGGGCTGGGGTAGGG - Intergenic
961906668 3:130269883-130269905 CTGGGGCAGGGGCAGGGGCAGGG - Intergenic
961946347 3:130692998-130693020 AATTGCCAGGTGCTGGGGGAAGG - Intronic
963945816 3:151144767-151144789 CTGGGACAGGTGGTGGGGAAGGG - Intronic
964395524 3:156241669-156241691 CTCTCCCAGGTGCTAGGGAAGGG - Intronic
964704609 3:159604496-159604518 CTGTGCCAGGCACTGTGCCAGGG + Intronic
965036222 3:163441625-163441647 CTTTGCCAGGCGCTGAGGGAAGG - Intergenic
967011354 3:185437742-185437764 CTGTGCTAGGTGCTTTGGGAGGG + Intronic
967881836 3:194306993-194307015 CCTTGCCAGCTCCTGGGGCAGGG - Intergenic
967970402 3:194994953-194994975 TTGGGGCAGGAGCTGGGGCAGGG - Intergenic
968425301 4:519298-519320 CTGTGCCAGGCGCTGTGCCAGGG - Intronic
968724803 4:2241872-2241894 CTGGGCGAGGAGCTGGGGCGGGG - Intronic
968726645 4:2250987-2251009 AGGTGCCTGGTGCTGGGGCTGGG - Intronic
968881626 4:3303163-3303185 GTGGGACAGGTGCTTGGGCAGGG + Intronic
969045961 4:4336957-4336979 GTGTGCCAGGGGCTGGGGTCAGG + Intergenic
969338831 4:6527902-6527924 CTGTCCCAGGAGCTGGGGAAGGG + Intronic
969369497 4:6722812-6722834 GGGTGCCAGGGGCTGGGGCATGG - Intergenic
969838160 4:9860289-9860311 CTGTGCCAGATGGCTGGGCAGGG - Intronic
970246522 4:14070300-14070322 CTCTGGCAGGTGCTGGAGCTGGG + Intergenic
971369291 4:26003007-26003029 CTGTGAGAGGTGGTGGTGCAGGG - Intergenic
971960929 4:33486206-33486228 CTGTTCCACTTGCTGGGGAAGGG - Intergenic
972401294 4:38706128-38706150 TTGTGCCTGGTGCTGGGGATTGG - Intergenic
974276665 4:59729255-59729277 CTGTTCAAGGTGGTGGTGCAAGG + Intergenic
974881430 4:67762838-67762860 CGGTGCCAGGGGCTGGGGTTTGG - Intergenic
974908184 4:68082731-68082753 CTGTGGCTGGTGCTGCAGCAGGG + Intronic
975695291 4:77007025-77007047 CTGTACATTGTGCTGGGGCAGGG + Intronic
976745236 4:88396360-88396382 CTGTACCAGGTGCTGGAGAATGG + Intronic
978058909 4:104311726-104311748 CACTGCCAGATGATGGGGCAAGG - Intergenic
978401998 4:108341068-108341090 CTGTGCCAGGTGTTGGGCCTGGG + Intergenic
978828774 4:113057077-113057099 CTGTGTTAGGTGCTATGGCATGG + Intronic
979114956 4:116812014-116812036 CTGGGCCAGGGGCTGGGGGCTGG + Intergenic
980805889 4:137812726-137812748 CTGTGCCATTTTCTGGGGCCAGG + Intergenic
981430612 4:144654670-144654692 CTGTGCTGGGGGCAGGGGCAGGG - Intronic
982134401 4:152259497-152259519 CTGTGGCAGGGGGAGGGGCATGG - Intergenic
982277966 4:153656214-153656236 CTGTGCCAGGAACTGGTACAGGG - Intergenic
982378116 4:154717021-154717043 CTGTGCTAGGCACTGGGCCACGG - Intronic
982759528 4:159264758-159264780 GGGTGACAGGTGCTGGGGGAAGG - Intronic
983275291 4:165609461-165609483 CAGCGCCAGGTGCTGTGGCATGG - Intergenic
985625302 5:982498-982520 CTGGGCCTGGAGCTGGGGAAAGG - Intergenic
985682582 5:1264344-1264366 CTGGGGCAGGTGCTGCTGCAGGG - Intronic
985790878 5:1926363-1926385 TTGGGGCAGGGGCTGGGGCAGGG - Intergenic
985790976 5:1926635-1926657 CTGGGGCAGGCGCAGGGGCAGGG - Intergenic
985849607 5:2379017-2379039 CTCTGCAAGATGCTGGGACAGGG + Intergenic
985921637 5:2981845-2981867 CCTTGCGAGGTGCTTGGGCAGGG + Intergenic
986061120 5:4192072-4192094 CTGGGCCAGGTGCAGTGCCATGG - Intergenic
986182761 5:5408954-5408976 CTGTTTCATGTGCTGGGACATGG - Intergenic
986516915 5:8574066-8574088 CAATGCCAGGTGCTGGACCAAGG - Intergenic
986674126 5:10168606-10168628 CTGTGCCAGTGGCAGGGGCGAGG - Intergenic
986733270 5:10650120-10650142 GTGTGCCTGGCGCTGGGGCCGGG + Exonic
986950759 5:13081262-13081284 CTGTGCCAGCTGCTGTGGCTTGG - Intergenic
987030458 5:13972278-13972300 CTGCGCCAGGTGGGGAGGCATGG - Intergenic
987077540 5:14398096-14398118 CTGTTCCTGGGGCTGGGGGATGG + Intronic
987887188 5:23828027-23828049 TTGTGCCAGGTCCTGGGGATGGG - Intergenic
988004159 5:25386359-25386381 ATGTTTCAGGTGCTGGGGTAGGG - Intergenic
988605641 5:32676401-32676423 CTGTTGCAGGTTCTTGGGCAGGG - Intergenic
989158777 5:38370420-38370442 CTGGGCCAGCTGCGGGGGCTGGG - Exonic
990738232 5:58887371-58887393 CAGGGCCTGGGGCTGGGGCAGGG + Intergenic
990844938 5:60126736-60126758 CTGTGCTAGGTGGTAGGGTAGGG + Intronic
991505123 5:67316808-67316830 CTGTACTATGTGCTGGGGAAAGG - Intergenic
991632922 5:68674795-68674817 GCGTGCTAGGTGCTGGGGAAGGG - Intergenic
992442359 5:76808183-76808205 CTGGGCCAGGGGTGGGGGCAGGG - Intergenic
995657759 5:114446061-114446083 CTGTACCAAGTACTGGGGCCAGG - Intronic
996680242 5:126222963-126222985 CTGTTGCAGGTTCTCGGGCAGGG + Intergenic
997472310 5:134123818-134123840 GAGAGCCAGCTGCTGGGGCAGGG + Intronic
998139961 5:139694166-139694188 GTCTGCCAGGTGCTTGGCCAAGG + Intergenic
998402595 5:141855776-141855798 CTGGGCAGGGAGCTGGGGCAAGG - Intronic
998626288 5:143850067-143850089 CTAGGTCAGGTGCAGGGGCATGG + Intergenic
998656517 5:144186914-144186936 CTGTGCCAGGTGCTGGGGATGGG + Intronic
1000021325 5:157321732-157321754 CTGTGCTGGGGGCTGGGGCAGGG + Intronic
1000319208 5:160120070-160120092 CTGCACTAGGTGCTGGGGAATGG + Intergenic
1001108782 5:168878024-168878046 CTGTGCTAGGTACTGGGCAAAGG - Intronic
1001247896 5:170118786-170118808 CTGTCACAGGTGAGGGGGCAAGG + Intergenic
1001264249 5:170260998-170261020 CTGCTCCAGGTTCTGGGCCAAGG + Intronic
1001297585 5:170509283-170509305 CTGTGCCTGGTGCTGGGTGTGGG - Intronic
1001334343 5:170785036-170785058 CTGGTACAGGTGCTGGGGGATGG - Intronic
1001540719 5:172536360-172536382 GATTGCCAGGTGCTGGGGCTGGG - Intergenic
1001667413 5:173444767-173444789 GGGTGCCATGTCCTGGGGCAAGG + Intergenic
1002095258 5:176826995-176827017 GTTTGCCAGGGGCTGGGGCAAGG - Intronic
1002328781 5:178427785-178427807 CGTTGCCAGGGGCTGGGGGAGGG + Intronic
1002395548 5:178950243-178950265 CTGTGCCATGAGCTAGGGGAAGG + Intronic
1002946496 6:1766344-1766366 CTGTTTCAGGTGCTGGGGAAAGG + Intronic
1003030784 6:2598821-2598843 CTGAGCCAAGTGCTGGGGAGAGG + Intergenic
1003635613 6:7828941-7828963 CTGTGCCAAGCCCTGGGACACGG - Intronic
1003914121 6:10769642-10769664 CTGTGCCAGGTCCTGGGCAGAGG + Intronic
1005900920 6:30215462-30215484 CCATGCAAGGGGCTGGGGCAGGG - Intergenic
1006095708 6:31655402-31655424 ATGATGCAGGTGCTGGGGCACGG - Intronic
1006163608 6:32051905-32051927 TGTTGCCAGGGGCTGGGGCAAGG + Intronic
1006166773 6:32069978-32070000 CTGTGCTAGGGGCTTGTGCAGGG + Intronic
1006451582 6:34108719-34108741 GTGTGCCAGGTGCTGGGAGGTGG + Intronic
1006713100 6:36092855-36092877 CTGTGGAAGGTGCTGGGGACAGG + Intronic
1006940470 6:37748698-37748720 CTATGGCAGGTGCTGGGGGAAGG - Intergenic
1006942885 6:37764704-37764726 CTGTGCCGGGTGCTGGAGTTTGG - Intergenic
1007077731 6:39078545-39078567 CTGGGACAGGGGCAGGGGCAGGG - Intronic
1007111526 6:39315800-39315822 CTGTGCCAGGGTCTGTGCCAGGG - Intronic
1007111529 6:39315812-39315834 ATGTGCCAGGTGCTGTGCCAGGG - Intronic
1007284392 6:40737157-40737179 CTGTGCCAGGTGCTGGGACTCGG + Intergenic
1007513405 6:42391918-42391940 ATGTGCCAGGTGCTTGGCCAGGG + Intronic
1007746678 6:44047486-44047508 CTGTGCCAGGTGCTGTGCTTGGG - Intergenic
1008007720 6:46429652-46429674 CTGTGCCAGGTGCTAGAGAATGG + Intronic
1008480000 6:51976471-51976493 AGTTGCCAGGTGCTGGGGGAAGG + Intronic
1008661900 6:53677349-53677371 GGGTGCCAGGGGCTGGGGCGAGG - Intergenic
1011270160 6:85570280-85570302 ATGTGCCAGGTACTGGACCAAGG + Intronic
1011419409 6:87155751-87155773 CTGTGCCAGGTGAGGGCGCCCGG + Exonic
1011693148 6:89887989-89888011 ATGTGCCCTGTGCTGGGGCCTGG + Intergenic
1011805865 6:91071992-91072014 CTGTGAAAGTAGCTGGGGCAAGG + Intergenic
1012169754 6:96002833-96002855 CCTTGCCAGGTTCTGGGGAAGGG + Intergenic
1013000025 6:106012681-106012703 CTGGGGCAGGTGCTGGGAGAGGG - Intergenic
1013015822 6:106159789-106159811 CAGTGCCAAGTGCTGGCCCATGG + Intergenic
1015386653 6:132632454-132632476 CTGTACCAGGCTCTGTGGCAGGG + Intergenic
1015834361 6:137404053-137404075 GTGTGCCAGGTGCTAGGGGAAGG + Intergenic
1017011191 6:150064843-150064865 CTGTGACAGGTCCTGGGGGTAGG + Intronic
1017096757 6:150811720-150811742 CTGAGGCAGGGGCTGGGGCAGGG + Intronic
1018039000 6:159905188-159905210 CTGTGCTAGGCACTGGGACATGG - Intergenic
1018186483 6:161269519-161269541 CAGTCCCAGCTGCTGGGGGAGGG + Intronic
1018388019 6:163322232-163322254 CTGGGCCTGCTGCTGGAGCAGGG - Intergenic
1018731755 6:166656774-166656796 CTGAGCCAGGGGCTGGGGATCGG - Intronic
1019303344 7:320582-320604 CGTTGCCAGGAGCTGGGGGAGGG + Intergenic
1019451628 7:1101647-1101669 CAGGGCCCGGTGCTGGGACACGG - Intronic
1019483059 7:1275111-1275133 TTGTGCCAGGGCTTGGGGCATGG + Intergenic
1019587274 7:1812482-1812504 CGGTGCCAGGTGCAGTGGGAGGG + Intergenic
1019614199 7:1951600-1951622 CGGTGCCAGGGGCTGGGGCTGGG - Intronic
1019643675 7:2117949-2117971 CTGTGCAAGGGACTGGGGCCAGG - Intronic
1019779440 7:2930802-2930824 CAGAGCCAGGGGTTGGGGCAGGG - Intronic
1019885128 7:3897365-3897387 GGGTGCCAGGGGCTGGGGAAGGG - Intronic
1020127629 7:5541782-5541804 CCGTGCCAGGTGCTGGGGACAGG + Intronic
1020143106 7:5623079-5623101 CTGTGGCAGGTTCTGCGGAACGG + Exonic
1021275172 7:18641311-18641333 ATGGGCCAAGTGCTGGGGTAGGG - Intronic
1021370699 7:19842230-19842252 ATGTACCAGGTGCTGGGCAAAGG + Intergenic
1021698178 7:23293602-23293624 CTGTGCCAGGCGCTGGACTAAGG - Intergenic
1022138591 7:27472571-27472593 CTTAGCCAGGTGTTGGGGCATGG - Intergenic
1022559369 7:31333482-31333504 CACTCCCAGGTGCTGGGTCAGGG - Intergenic
1023970008 7:44983946-44983968 TTGTGCCATGTGCTGGGTCAGGG + Intergenic
1025234679 7:57226674-57226696 CTGTGCCAGGTGCTGTGCTCAGG + Intergenic
1026252734 7:68685112-68685134 CTTTGACAGGTGCCGGGGAAGGG - Intergenic
1026638550 7:72105214-72105236 CTAAGGCAGGTGCGGGGGCAGGG - Intronic
1027192152 7:76002965-76002987 CTGTACCAGGGGCTGGAGCATGG - Intronic
1027419667 7:78006681-78006703 GTGTGCCAGGTGCTGTGCAAGGG - Intergenic
1027421682 7:78023176-78023198 CTGAGGCAGGTGATAGGGCAAGG - Intronic
1029080703 7:97972011-97972033 TTGTGCCAGGTGCTGAGCCCGGG - Intergenic
1029202869 7:98850800-98850822 CAGTGGCAACTGCTGGGGCAGGG + Intronic
1029244359 7:99188228-99188250 CTTTAGCAGGTTCTGGGGCAAGG - Intronic
1029337551 7:99915281-99915303 TTGTGTCAGATGCTGTGGCACGG - Intronic
1029465421 7:100721711-100721733 CTGTGGAATGTGCTGGGGAAGGG - Intronic
1029479078 7:100802190-100802212 CTGGGGCAGGAGCTGGAGCAGGG - Intergenic
1029969996 7:104779547-104779569 CTGTGCCTGGTGCAGGGAGAGGG - Intronic
1030076722 7:105743267-105743289 CTGTGCCAAGAACTGGGGCCAGG + Intronic
1031528470 7:122849925-122849947 CTGGGCCAGGAGCTGGGGCCTGG - Intronic
1031917182 7:127574629-127574651 CAGTCCCAGGAGCTGTGGCAGGG + Intergenic
1032059654 7:128714066-128714088 CTATAACAGGTGCTGGAGCAGGG + Intronic
1032957420 7:136987201-136987223 CTGTGCTATGTGCTGGAGCAGGG - Intronic
1033142515 7:138840253-138840275 CTGTGTCAGGTGCTGGATCTGGG + Exonic
1033652807 7:143355124-143355146 CTGTGCCAAGGGCTGGGGAGGGG + Exonic
1034350060 7:150409652-150409674 ATGTGATAGGAGCTGGGGCAGGG + Intronic
1034430135 7:151037107-151037129 GGGTGCCAGGGGCTGGGGGAGGG - Intronic
1034875937 7:154724750-154724772 GGGTGCCAGGGGCTGGGGGAGGG + Intronic
1035631507 8:1110335-1110357 CTGTGACATGTGCTGGGTCTGGG + Intergenic
1035864406 8:3067057-3067079 CTGTGCCAGGTGCTAAGCCTGGG + Intronic
1036102604 8:5803173-5803195 CTCTGCCAGGGTCTGGGGGATGG - Intergenic
1036283688 8:7424127-7424149 CAGAGGCAGGTCCTGGGGCATGG + Intergenic
1036337782 8:7887402-7887424 CAGAGGCAGGTCCTGGGGCATGG - Intergenic
1036913005 8:12774656-12774678 CCGTGCTGGGTGCTGGGGCCAGG + Intergenic
1037374992 8:18217829-18217851 CTGTTGCAGGGGCTGGTGCAGGG + Intronic
1038051244 8:23814828-23814850 CTGTGGCAGCTGCTGAGGAATGG + Intergenic
1038271311 8:26078294-26078316 CTGTGACAGGAGGTGGGACAGGG - Intergenic
1038271327 8:26078357-26078379 CTGTGACAGGAGGTGGGACAGGG - Intergenic
1038317725 8:26501982-26502004 CTGTGCAGGGTGCTGGGGCTGGG - Intronic
1038425262 8:27460517-27460539 CTGTGCTAGGTGCTGGGGGTGGG + Exonic
1038433194 8:27516127-27516149 CTGTGGACGGTGGTGGGGCACGG - Intronic
1038805864 8:30790665-30790687 CTGCCCCAGGAGCTGGGGCAGGG + Intronic
1039353979 8:36795053-36795075 CTTTGCAAGGAGATGGGGCAGGG + Intronic
1039693323 8:39883825-39883847 CTGTTGCAGGTTCTTGGGCAGGG - Intergenic
1039971469 8:42324776-42324798 GTGGGGCAGGAGCTGGGGCAGGG + Intronic
1039978000 8:42383495-42383517 CTGTGCAATGTGCTGGTGCAGGG + Intergenic
1040561558 8:48527381-48527403 CTCTGCCAGGTGCTGGTGTGTGG - Intergenic
1040633945 8:49249973-49249995 GTGTGCCAAGTTCTGGGGTAGGG + Intergenic
1041248228 8:55909213-55909235 GTGTGCCACGTGATGGGCCAGGG + Intronic
1041424349 8:57703469-57703491 CTGTGCCAAGTCCTTGGCCAAGG + Intergenic
1042053690 8:64739112-64739134 CTGTGCCTGGGGCGGGGGTAAGG - Intronic
1042555802 8:70033065-70033087 CTGCGCCAGGTGGAGGGGAAGGG + Intergenic
1042665097 8:71195697-71195719 CTGTCCCAGGTGCTGAGGGTAGG - Intergenic
1044222788 8:89688923-89688945 ATGAGCCAGGTGCAGTGGCATGG + Intergenic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1045036045 8:98177169-98177191 CAGTGCCAAGTGCTGGGGCAGGG - Intergenic
1045282130 8:100758366-100758388 CTGTGTCTGGTGATGGAGCAAGG - Intergenic
1046868489 8:119177293-119177315 CTGTGCCAGGCACTAGGGCATGG + Intronic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1047628512 8:126680917-126680939 CTGTGCCAGGGTCTGTGGCATGG - Intergenic
1047916518 8:129589738-129589760 CTTTGCCAGGTGCTGCAGGATGG - Intergenic
1048040211 8:130720290-130720312 CTGTGCCAGGTGCTATGACAGGG - Intergenic
1048144690 8:131829959-131829981 CTGTGCCAGGTGTTGGGTGATGG + Intergenic
1048883331 8:138888146-138888168 CTGTGCCAGGTGCTGAGGATAGG + Intronic
1049093688 8:140535300-140535322 CTGTGCCAGGCGCTGGGGTGGGG - Intronic
1049201156 8:141341306-141341328 ATGTGCCAGGGCTTGGGGCAGGG + Intergenic
1049237860 8:141521545-141521567 CTGTGCCTGATGCTGAGGCTGGG + Intergenic
1049264736 8:141661555-141661577 CTGTGACTGGTGGTGGTGCAGGG + Intergenic
1049264914 8:141662666-141662688 CTGAGCCTGGGGCTGGGGAAGGG + Intergenic
1049403272 8:142440350-142440372 CTGTGGCAGGTGGGGAGGCAGGG + Intergenic
1049519654 8:143081352-143081374 AGGTGCCAGGTGCCGGGGAAGGG + Intronic
1049612503 8:143562057-143562079 CTGTGCCAGCTGCTGCTGGAGGG + Exonic
1049684481 8:143933876-143933898 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
1049711963 8:144068849-144068871 CTGTGGCAGGTGTTGGGGGACGG - Intergenic
1049805532 8:144537128-144537150 CTGAGCCAGGGCCTGGGGGAAGG + Intronic
1050107946 9:2185186-2185208 GGGTGCCAGGGGCTGGGGGAAGG - Intronic
1051930119 9:22374900-22374922 CTGTGCCAGGAACTAGGCCAAGG + Intergenic
1052168694 9:25366222-25366244 ATGTGCCAGGTGCTGTGCTAAGG + Intergenic
1053172057 9:35894842-35894864 CTGTGCCTGGTGCTGAGGCTGGG - Intergenic
1053312914 9:37030574-37030596 CTGTGCTAGGCGCTGGGGGCAGG + Intronic
1053838181 9:42163330-42163352 CTTAGCCAGGTGCAGTGGCAGGG - Intergenic
1053894452 9:42729324-42729346 CTTTGTCAGGTTCTGAGGCAGGG + Intergenic
1055351250 9:75390816-75390838 ATGTGCCAGGTGCTGGGTAGTGG - Intergenic
1056580526 9:87885971-87885993 CTGGGCCATGTGGTGGGGCTGGG - Exonic
1056725291 9:89109099-89109121 CTGGGCCAGGTCCTGGGGATAGG + Intronic
1057311081 9:93943697-93943719 CTGAGGCAGGGGCAGGGGCAGGG - Intergenic
1057828667 9:98390676-98390698 CTGAGCCAGGTGTTTGGGGAAGG - Intronic
1057911166 9:99021596-99021618 TTGTGCCAGGTGCTGGGACCTGG + Intronic
1058702315 9:107611400-107611422 CAGTGCTAGGTGCTGGGTTATGG + Intergenic
1060040674 9:120297744-120297766 CTGTGCCAGTTTCTAGGCCAAGG + Intergenic
1060223189 9:121775037-121775059 CTCTGCCATCTGCTGGGGCAAGG + Intronic
1060361277 9:122959846-122959868 CTGTCCCAGGAGCAGGGGCTGGG - Intronic
1060398267 9:123331672-123331694 ATGTGGCAGGGCCTGGGGCAGGG - Intergenic
1060934750 9:127508480-127508502 CTGCACCAGGAGCTGGGGAAGGG - Exonic
1061209643 9:129183365-129183387 CTTTGCCAGATGCTGGAGCAGGG - Intergenic
1061252014 9:129431999-129432021 CTGGGCCTGGAGCTGGGGCTAGG + Intergenic
1061294567 9:129669998-129670020 GGGTGCCAGGGGCTGGGGGAGGG - Intronic
1061543793 9:131292081-131292103 CTCTTCCAGGTGCTGTGCCATGG + Intronic
1061621186 9:131812354-131812376 CTGTGCCAGGATCTGTGCCAAGG - Intergenic
1061862012 9:133473021-133473043 CAGTGCCAGGGGCTGTGCCAAGG - Intronic
1062025665 9:134339072-134339094 GTGTGCCTGGTGTCGGGGCAGGG + Intronic
1062096582 9:134706919-134706941 CTGGGGAAGGTGCTGGGACAGGG - Intronic
1062113422 9:134795185-134795207 ACGTGCCAGGGGCTGGGGGAAGG + Intronic
1062179879 9:135185607-135185629 CGCTGCCAGGTGGCGGGGCATGG - Intergenic
1062207933 9:135347417-135347439 GCTTGCCGGGTGCTGGGGCAGGG - Intergenic
1062219366 9:135406226-135406248 GTATGCCAGGTGCGGGGACAGGG - Intergenic
1062236512 9:135512509-135512531 CTGTGTCAGGGTCTGGGGAAGGG + Intergenic
1062338915 9:136084910-136084932 GCCTGCCAGGGGCTGGGGCAAGG + Intronic
1062348844 9:136128870-136128892 GGGTGCCAGGGGCTGGGGCAGGG + Intergenic
1062459537 9:136657143-136657165 CTGTGCCATGTACTGGCGCCAGG + Intergenic
1062463325 9:136670920-136670942 CAGAGCCAGGCGCTGGGTCACGG - Intronic
1062464708 9:136675869-136675891 CTGTGCAAGGTGGTGGGGAGGGG - Intronic
1062482763 9:136760035-136760057 CTCAGCCAGGGACTGGGGCATGG - Intronic
1062570192 9:137181391-137181413 CTCTGCCAGGTGCAGTGGCGGGG + Intronic
1062597194 9:137304702-137304724 CTGTTCCAAATGCTGGGACACGG + Intergenic
1062652127 9:137583383-137583405 CAGTCCCAGGTGCTGGGGAGAGG - Intronic
1062729245 9:138099942-138099964 ATCTGCCATGTGCTGGGGCAGGG + Intronic
1185955373 X:4483421-4483443 CTGGACCAGGTGCTGCTGCAAGG - Intergenic
1187052883 X:15712192-15712214 CTGGGCCAGTTTCTTGGGCATGG + Intronic
1187318323 X:18219141-18219163 CTGTGGCAAGTGCTGGGCGATGG - Intronic
1187391531 X:18889502-18889524 CTATGCCAGCTGCAGGGGAAAGG + Intergenic
1187404693 X:18992630-18992652 CTATCCCAGATGCTGGGGCAAGG + Intronic
1187411339 X:19053148-19053170 CTGTGTCAGGAACAGGGGCAAGG - Intronic
1187475702 X:19609035-19609057 CTGAGCCAGGTGCTAGAGAAAGG + Intronic
1188136369 X:26499135-26499157 CTGTTGCAGGTTCTTGGGCAGGG + Intergenic
1188668251 X:32851689-32851711 CTCTGCCAGGGGATGGGGGAGGG - Intronic
1188716563 X:33465526-33465548 CAGTGTCAGGGGCTGGGGGAAGG + Intergenic
1189295311 X:39913647-39913669 CTGTGCCTGGTGCCTTGGCAAGG + Intergenic
1189849715 X:45166274-45166296 CCGTGCCAAGTACTGGGCCAGGG + Intronic
1190056906 X:47186410-47186432 CTGTGAGGGGTGCTGGGGGATGG - Intronic
1190097314 X:47492026-47492048 ATATCCCAGGAGCTGGGGCAAGG + Intergenic
1190336690 X:49267016-49267038 GGGGGACAGGTGCTGGGGCAGGG - Intergenic
1192172592 X:68866260-68866282 CTCTGCCATGTGCTTGGGGAGGG - Intergenic
1192178337 X:68899603-68899625 ATGTGCCAGGTGCTCTGGAATGG + Intergenic
1192413668 X:70958072-70958094 GTGTGCCAGGTGTAGTGGCAAGG + Intergenic
1192536578 X:71933690-71933712 TTGTGCCAGGCACTGTGGCAAGG - Intergenic
1192586655 X:72324460-72324482 CTGTGCCAGGTTGGGGGGCTGGG - Intergenic
1192664397 X:73072613-73072635 GTTTACCAGGGGCTGGGGCAAGG + Intergenic
1194244897 X:91499109-91499131 CTGTGCTAGGAGCTTGGGAATGG - Intergenic
1195439421 X:104884418-104884440 CTGTTGCAGGTTCTTGGGCAGGG + Intronic
1196013689 X:110915135-110915157 ATGTGGCAGGTGGTGGGGCGAGG + Intergenic
1196488835 X:116245165-116245187 CTGTTGCAGGTTCTTGGGCAGGG + Intergenic
1196940018 X:120766341-120766363 CTGGGTCAGGGGTTGGGGCAGGG + Intergenic
1197753210 X:129979809-129979831 GTGGGACAGGTGCTGGGGAAAGG - Intergenic
1198020712 X:132655141-132655163 CATTACCAGATGCTGGGGCAGGG - Intronic
1198080026 X:133231014-133231036 GGTTGCCAGGGGCTGGGGCATGG - Intergenic
1198099997 X:133415167-133415189 CGGTGCCAGGCGCCGGGCCAGGG + Exonic
1198208326 X:134491179-134491201 GTTTGCTAGGTGCTGGGGGAAGG - Intronic
1198214876 X:134546379-134546401 CTGTTCCCGCTGCTAGGGCACGG + Intergenic
1198405102 X:136304569-136304591 CTGTGCTAACTCCTGGGGCAGGG + Intronic
1198494401 X:137176914-137176936 CTGTATCAGGTGCTGGGGACAGG + Intergenic
1198830999 X:140750248-140750270 GTTTGCCAGGGGCTGGGGTAAGG + Intergenic
1198886280 X:141342268-141342290 TTGTCCTAGGTGCTGAGGCATGG + Intergenic
1198886544 X:141344439-141344461 CTGTGGCAGGTACTGCTGCAGGG + Intergenic
1199296443 X:146164271-146164293 CTGTGCCAGGTTCTGTGCTAAGG - Intergenic
1199503576 X:148536387-148536409 CTGTGCTGGGAACTGGGGCAAGG - Intronic
1200112102 X:153745621-153745643 GGGTGTCAGGGGCTGGGGCAGGG + Intergenic
1200213792 X:154358568-154358590 CTGTCCCTGGGGCTGGGGCCAGG - Exonic
1200216291 X:154369514-154369536 CTGGCCCAGGGGCTGGGGAAAGG - Intronic
1200401932 X:156024873-156024895 CAGTGCCCGGTGCTGGGTCAGGG + Intergenic
1200563873 Y:4740419-4740441 CTGTGCTAGGAGCTTGGGAATGG - Intergenic
1200972239 Y:9164924-9164946 CAGTTCCAGGTGCTGGCACAGGG - Intergenic
1201523614 Y:14905214-14905236 GGGTGCCAGGTGCTGGGGGAGGG + Intergenic
1201631120 Y:16072920-16072942 CTGTCACAGGTTCTTGGGCAGGG + Intergenic
1202138784 Y:21699360-21699382 CAGTTCCAGGTGCTGGCACAGGG + Intergenic
1202583281 Y:26403266-26403288 CTATGGCTGGGGCTGGGGCAGGG + Intergenic