ID: 952953688

View in Genome Browser
Species Human (GRCh38)
Location 3:38543714-38543736
Sequence GTGGCCATCAGGGCTGATAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 6, 3: 10, 4: 120}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952953683_952953688 -3 Left 952953683 3:38543694-38543716 CCTCCTGGGCTTTGAGTCTCGTG 0: 1
1: 0
2: 0
3: 11
4: 125
Right 952953688 3:38543714-38543736 GTGGCCATCAGGGCTGATATCGG 0: 1
1: 0
2: 6
3: 10
4: 120
952953681_952953688 2 Left 952953681 3:38543689-38543711 CCCAACCTCCTGGGCTTTGAGTC 0: 1
1: 0
2: 2
3: 13
4: 208
Right 952953688 3:38543714-38543736 GTGGCCATCAGGGCTGATATCGG 0: 1
1: 0
2: 6
3: 10
4: 120
952953678_952953688 7 Left 952953678 3:38543684-38543706 CCCCTCCCAACCTCCTGGGCTTT 0: 1
1: 0
2: 11
3: 37
4: 543
Right 952953688 3:38543714-38543736 GTGGCCATCAGGGCTGATATCGG 0: 1
1: 0
2: 6
3: 10
4: 120
952953685_952953688 -6 Left 952953685 3:38543697-38543719 CCTGGGCTTTGAGTCTCGTGGCC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 952953688 3:38543714-38543736 GTGGCCATCAGGGCTGATATCGG 0: 1
1: 0
2: 6
3: 10
4: 120
952953675_952953688 12 Left 952953675 3:38543679-38543701 CCTGGCCCCTCCCAACCTCCTGG 0: 1
1: 1
2: 10
3: 170
4: 3005
Right 952953688 3:38543714-38543736 GTGGCCATCAGGGCTGATATCGG 0: 1
1: 0
2: 6
3: 10
4: 120
952953674_952953688 13 Left 952953674 3:38543678-38543700 CCCTGGCCCCTCCCAACCTCCTG 0: 1
1: 2
2: 17
3: 336
4: 1192
Right 952953688 3:38543714-38543736 GTGGCCATCAGGGCTGATATCGG 0: 1
1: 0
2: 6
3: 10
4: 120
952953673_952953688 28 Left 952953673 3:38543663-38543685 CCTGGGCTTCTGTCTCCCTGGCC 0: 1
1: 1
2: 5
3: 79
4: 607
Right 952953688 3:38543714-38543736 GTGGCCATCAGGGCTGATATCGG 0: 1
1: 0
2: 6
3: 10
4: 120
952953680_952953688 5 Left 952953680 3:38543686-38543708 CCTCCCAACCTCCTGGGCTTTGA 0: 1
1: 0
2: 1
3: 30
4: 693
Right 952953688 3:38543714-38543736 GTGGCCATCAGGGCTGATATCGG 0: 1
1: 0
2: 6
3: 10
4: 120
952953682_952953688 1 Left 952953682 3:38543690-38543712 CCAACCTCCTGGGCTTTGAGTCT 0: 1
1: 0
2: 0
3: 25
4: 264
Right 952953688 3:38543714-38543736 GTGGCCATCAGGGCTGATATCGG 0: 1
1: 0
2: 6
3: 10
4: 120
952953679_952953688 6 Left 952953679 3:38543685-38543707 CCCTCCCAACCTCCTGGGCTTTG 0: 1
1: 0
2: 8
3: 47
4: 421
Right 952953688 3:38543714-38543736 GTGGCCATCAGGGCTGATATCGG 0: 1
1: 0
2: 6
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952953688 Original CRISPR GTGGCCATCAGGGCTGATAT CGG Intergenic
900274723 1:1817111-1817133 GTGGCCAGCAGGGGTGTTAGGGG - Intronic
900812683 1:4819732-4819754 GTGGCCATCTGGTCTGAGTTAGG + Intergenic
904360250 1:29966507-29966529 GTAGCCATCAGGGTTCATTTAGG + Intergenic
904621194 1:31776399-31776421 GCTGCCATCAGGGCTGAGACAGG - Intergenic
906565620 1:46799126-46799148 GTGGGCTTCTGGGCTGATCTTGG + Exonic
909500179 1:76326096-76326118 GTTGCCATCCAGGCTGAGATCGG + Intronic
921257652 1:213356980-213357002 GTGGTCACCAGGGCTGCTGTGGG + Intergenic
922478362 1:225922178-225922200 AGGGGCATCAGGGCTGAGATGGG + Intronic
923134947 1:231109454-231109476 GTGGCCATCAGAGCTGCCACTGG + Intergenic
1065495028 10:26318910-26318932 CTGGCCATCAGGCCTCATAAAGG + Intergenic
1071823001 10:89297129-89297151 GTGGCCAGCTTGGCTGAGATTGG + Intronic
1072522469 10:96240593-96240615 GTGGCCATCAGGATAGACATAGG + Intronic
1073792238 10:106952259-106952281 GTGACCAGAAGGGCTGAGATTGG + Intronic
1077223143 11:1426173-1426195 GTGGCCATCAGGGCCTGGATGGG + Intronic
1077288283 11:1777359-1777381 GGGACCATCAGGGCTGAGTTAGG + Intergenic
1078901497 11:15646891-15646913 GTGGCCATCAGGGCAAATGGAGG - Intergenic
1084921700 11:72476036-72476058 GAGGCCAGGAGGGCTCATATTGG - Intergenic
1084966220 11:72746087-72746109 CTGGCCATCAGGGCCAGTATGGG - Intronic
1085304207 11:75476036-75476058 TTGGCCATCAGGGCAGATGCTGG - Intronic
1085417398 11:76328443-76328465 GGGGCCACCTGGGCTGCTATGGG - Intergenic
1087192061 11:95265426-95265448 GTGGCAATGAAGGCTGATACAGG + Intergenic
1087690944 11:101320220-101320242 GTGGCCATCACCACTGAGATTGG + Intergenic
1088757270 11:112895938-112895960 GTGGACATCTGGGCTGATGGGGG - Intergenic
1089576770 11:119450076-119450098 ATGGGCATCAGGGCTGACGTGGG + Intergenic
1091021746 11:132106034-132106056 GTGGCAACCAGGGTGGATATTGG + Intronic
1093120366 12:15264080-15264102 GTGGACATCATGGCAGAGATTGG + Intronic
1097030717 12:56087529-56087551 GGGGCCATCAGGGCTAAGAAAGG - Intronic
1102512186 12:113422996-113423018 GCAGCCACCAGGGCTGAAATGGG - Intronic
1102815874 12:115866015-115866037 GTTGCCATCTTGGCTGATCTCGG - Intergenic
1102842346 12:116138608-116138630 GTGGCCATCAGGACAAATCTGGG + Intronic
1113794068 13:113046608-113046630 GTGGGCATCGGAGCAGATATGGG - Intronic
1114032378 14:18588289-18588311 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1114076422 14:19163753-19163775 GTGGGCATCAGGCCTGATATTGG - Intergenic
1114077159 14:19167315-19167337 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1114085005 14:19232249-19232271 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1114085746 14:19235816-19235838 GTGGGCATCAGGCCTGATATTGG + Intergenic
1117221267 14:53608887-53608909 GTGGCCATCTGGGCAGAGAAAGG - Intergenic
1120805426 14:88743114-88743136 GTGGCTATCAAGGCTGAGAGAGG + Intronic
1122403112 14:101479112-101479134 CTGGACAGCAGTGCTGATATGGG + Intergenic
1122783839 14:104154948-104154970 GTGGTCCTCACGGCTGAGATGGG + Intronic
1123998138 15:25733304-25733326 CTGGGCATCAGGACTGGTATGGG + Intronic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1124848750 15:33315639-33315661 GTGTCCAGCTCGGCTGATATGGG - Intronic
1127269942 15:57391284-57391306 GTGCCCATAAGGGATGACATAGG + Intronic
1128285187 15:66430551-66430573 GTGACCATCAGGGTTGAAAAGGG + Intronic
1129802056 15:78422479-78422501 GTGGCCTTCAGAGCTGAGACTGG - Intergenic
1131111269 15:89766652-89766674 GGGGCCATCAGGGCAGATTCTGG - Intronic
1131736431 15:95337740-95337762 CTGGCCATCATGGCTCATAAAGG + Intergenic
1138512131 16:57515015-57515037 GGGGCCAGCAGGGCTCAAATAGG - Intronic
1142217858 16:88838588-88838610 GTGGCCTGCAGGGCTGCTGTGGG - Intronic
1147244163 17:39109518-39109540 GTGGCCCCAAGGGCTGATTTAGG + Intronic
1148123530 17:45225460-45225482 GTGGCCATGTGGTCTGATGTTGG + Intronic
1157587160 18:48810199-48810221 GTGGCTATCCCGACTGATATGGG - Intronic
1157646968 18:49284349-49284371 ATATCCATCAGGGCTGATCTTGG - Intronic
1160406477 18:78649756-78649778 GAGGCCATCAGAGCTGAGAATGG - Intergenic
1165435340 19:35792039-35792061 GTGGCCACCGGGGCTGGTAACGG - Intergenic
1165767436 19:38360084-38360106 GTGGGCATCAGTGCAGAGATGGG + Intronic
1165874573 19:38996968-38996990 GTGGCCATCATTGCTGACATAGG + Intronic
1166384883 19:42375463-42375485 GTGACCATCAGGGCTGAGTGCGG - Intronic
1168071036 19:53951943-53951965 CTGTCCATCAGGGCTGAGCTGGG + Intergenic
925476743 2:4225256-4225278 GCAGCCATAAGAGCTGATATTGG + Intergenic
927403664 2:22743160-22743182 GTGGCCAGGAGGGCAGATAGGGG + Intergenic
928738905 2:34326200-34326222 GAGGACAACAGGGCTTATATGGG - Intergenic
933188863 2:79310906-79310928 GTGGCCATCTGTGCTCAGATTGG + Intronic
935199715 2:100845602-100845624 CTGCCCACCAGGGCTGACATTGG - Intronic
938491018 2:131761268-131761290 GTGGGCATCAGGCCTGATATTGG - Intronic
942547670 2:177081509-177081531 GCGGCCATCAGAGCTGAGGTGGG - Intergenic
1169199774 20:3703268-3703290 TTGGCCACTAGGGCTGATACTGG - Exonic
1173486939 20:43447998-43448020 GTGGCCCTCAGAGCTGACCTTGG - Intergenic
1175617739 20:60416253-60416275 GTAGTCTTCAGGGCTTATATTGG + Intergenic
1176616981 21:9033518-9033540 GCGGGCATCAGGCCTGATATTGG + Intergenic
1176708149 21:10130128-10130150 GCGGGCATCAGGCCTGATATTGG - Intergenic
1176708862 21:10133679-10133701 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1178761149 21:35404079-35404101 GTGGACACCAGTGCTGAAATGGG - Intronic
1179073873 21:38099583-38099605 GTGGCCATCAGGGGTGTCTTAGG + Intronic
1180292228 22:10857377-10857399 GTGGGCATCAGGCCTGATATTGG - Intergenic
1180292965 22:10860944-10860966 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1180456489 22:15515346-15515368 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1180495033 22:15886799-15886821 GTGGGCATCAGGCCTGATATTGG - Intergenic
1180495771 22:15890366-15890388 GTGGACATCAGGCCTGAGAAGGG + Intergenic
949930153 3:9072103-9072125 GTTGGGATCAGGACTGATATGGG - Intronic
952953688 3:38543714-38543736 GTGGCCATCAGGGCTGATATCGG + Intergenic
953032010 3:39185543-39185565 CTGGCCAGCAGGGCTGCTGTGGG + Exonic
955118497 3:56031153-56031175 GTGGTCATTAGGGCTGACCTGGG - Intronic
964726206 3:159816708-159816730 GAGGTCAGCAGGGCTGATATAGG - Intronic
966309756 3:178580083-178580105 ATGTTCATCAGGCCTGATATTGG - Intronic
969515944 4:7648332-7648354 GGGGTCATCAGGGCAGAAATGGG + Intronic
977685716 4:99845210-99845232 GTAAACATCAGGGCTGAGATTGG + Intronic
977824661 4:101516966-101516988 GTTGCCAGCAGAGCTGAAATAGG + Intronic
985590490 5:761972-761994 GTGGCCATCATGGCTGTGAGTGG - Intronic
985590523 5:762133-762155 GTGGCCATCTGGGCTGTGAGTGG - Intronic
985590541 5:762217-762239 GTGGCCATCTGGGCTGTGAGTGG - Intronic
987298001 5:16571145-16571167 GTTGCCATCAGGGAGGAGATGGG + Intronic
993067941 5:83124288-83124310 GTGGCTACCAGGGATTATATTGG - Intronic
993402209 5:87467514-87467536 GTGGCCAGCTTGGCTGAGATTGG - Intergenic
998870686 5:146548634-146548656 CTGGCCACCAGGGATGATACAGG - Intergenic
1002940859 6:1714495-1714517 ATGGCCATCATGGCTGGTATTGG - Intronic
1006152103 6:31995147-31995169 GTCCCCATCAGGGATCATATTGG - Exonic
1006158405 6:32027885-32027907 GTCCCCATCAGGGATCATATTGG - Exonic
1006868662 6:37230352-37230374 AAGGCCATAAGGGCTGTTATGGG + Intronic
1007338343 6:41171547-41171569 ATGGCCATCAGGGCAAAAATGGG + Intergenic
1013342402 6:109227832-109227854 GTGGCCTCCAGGGCTGCTTTAGG - Intergenic
1017626025 6:156349693-156349715 GGGGCCACCAGGTCTGTTATGGG - Intergenic
1017898570 6:158701892-158701914 GTGACCATCAGGGCAGAGACTGG - Intronic
1018110952 6:160536458-160536480 GTGGGCTGCAGGGCTGTTATGGG - Intronic
1018995180 6:168704930-168704952 GTGACCAGCAGGGCAGAAATGGG + Intergenic
1025833325 7:65073768-65073790 GTGGCAATCAGTGCTGAAAGGGG - Intergenic
1027903501 7:84149772-84149794 GTGGCCAGCAGGGATTAAATAGG - Intronic
1028752441 7:94395459-94395481 GTGGACATCAGTGCGGTTATGGG - Intronic
1029862103 7:103583727-103583749 GTAGCCAGCATGGCTGAGATTGG + Intronic
1035454042 7:158997471-158997493 GTGGGAATCAGGGCAGAAATAGG + Intergenic
1036506527 8:9361626-9361648 GTGGTGAGCAGGGCTGATAGAGG - Intergenic
1036772269 8:11587370-11587392 GTCGCCATCATGGTTGCTATAGG - Intergenic
1039207198 8:35170288-35170310 ATGGGCCTCAGGGCTGAAATGGG + Intergenic
1041513193 8:58673421-58673443 GAGACCATCCGGGCTAATATGGG + Intergenic
1043740097 8:83800950-83800972 GTGGCCACCATCACTGATATTGG + Intergenic
1048881306 8:138874892-138874914 GAGTCCATGAGGGCTGAGATTGG - Intronic
1051587934 9:18746864-18746886 GCAGCCATCAGGGTTAATATGGG - Intronic
1053645112 9:40115642-40115664 GCGGGCATCAGGCCTGATATTGG - Intergenic
1053645838 9:40119176-40119198 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1053645844 9:40119203-40119225 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1053759874 9:41344333-41344355 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1053760606 9:41347886-41347908 GCGGGCATCAGGCCTGATATTGG + Intergenic
1054326135 9:63713540-63713562 GTGGGCATCAGGCCTGATATTGG - Intergenic
1054326850 9:63717077-63717099 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1054326856 9:63717104-63717126 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1054538727 9:66256769-66256791 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1054538733 9:66256796-66256818 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1054539461 9:66260329-66260351 GCGGGCATCAGGCCTGATATTGG + Intergenic
1062386140 9:136312251-136312273 GTGGCCTTCAGGGTTGAGTTTGG - Intergenic
1202792912 9_KI270719v1_random:99097-99119 GCGGGCATCAGGCCTGATATTGG - Intergenic
1202793623 9_KI270719v1_random:102649-102671 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1186417484 X:9396327-9396349 GCGGCCATAAGGGGTGACATGGG - Intergenic
1188945595 X:36297560-36297582 GTGGAGATCATGGCTGAAATGGG + Intronic
1197447829 X:126573010-126573032 GTGGCCATCAAAGGTGATGTGGG - Intergenic
1199979363 X:152912460-152912482 GTGGCCATCAGGTTTGACAAGGG + Intergenic
1201150380 Y:11092369-11092391 GCGGGCATCAGGCCTGATATTGG + Intergenic