ID: 952958846

View in Genome Browser
Species Human (GRCh38)
Location 3:38577198-38577220
Sequence CGGGCAACACACAGGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952958839_952958846 3 Left 952958839 3:38577172-38577194 CCAGAACAGAGTCAGAACCAGGA 0: 1
1: 0
2: 1
3: 17
4: 264
Right 952958846 3:38577198-38577220 CGGGCAACACACAGGCAGCAAGG 0: 1
1: 0
2: 1
3: 13
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952958846 Original CRISPR CGGGCAACACACAGGCAGCA AGG Intronic
900439240 1:2645118-2645140 CAGGCCTCACACAGGGAGCAGGG + Intronic
900518985 1:3096597-3096619 CTTTCAACACACAGGCGGCAAGG - Intronic
900646824 1:3712865-3712887 GGGGCACCACACGGGCTGCAAGG - Intronic
901702930 1:11054976-11054998 CGGGCAGCACAAAGGCGGCGCGG + Exonic
902683258 1:18058692-18058714 ATGGCAACCCACAGGCAGCGGGG + Intergenic
904030191 1:27528692-27528714 CGGGCCACACACAGACACAAAGG - Intergenic
904617865 1:31759746-31759768 CTGGCTATACACAGGCAGGAGGG - Intronic
905107940 1:35575078-35575100 CTGGCGACACACAGGAGGCACGG - Intronic
905249824 1:36640780-36640802 CTGCCAACAAACAGGCTGCATGG - Intergenic
906285900 1:44587646-44587668 TGGCCAACAGACAGGCATCAGGG + Intronic
906556184 1:46716367-46716389 AGGCCACAACACAGGCAGCAAGG + Exonic
906790200 1:48652498-48652520 TGGTGGACACACAGGCAGCAGGG + Intronic
907881089 1:58549847-58549869 GGCCCAACACACAGGCAGCTGGG + Intergenic
914767333 1:150650261-150650283 CTGGCAACACACAGGGAGTTAGG + Intronic
915062696 1:153199382-153199404 TGGCCAACACCCAGCCAGCAGGG + Intergenic
915248558 1:154572594-154572616 TGTGCACCACACAGGCAGGAGGG + Intronic
915889014 1:159753678-159753700 CAGGAAACCCACAGGCACCAGGG + Intergenic
916951526 1:169785202-169785224 GGGGGAGCACACAGGCAGGAAGG + Intronic
920112749 1:203598654-203598676 CTGGCCCCACACAGCCAGCAGGG - Intergenic
920302115 1:204995512-204995534 CGGTCAACCCACAGACATCAGGG - Intronic
1063053244 10:2475955-2475977 AAGGGAACACGCAGGCAGCAGGG - Intergenic
1063629515 10:7720967-7720989 CTGGCAACACACAGGGCTCAGGG - Intronic
1064875229 10:19986585-19986607 TGGGTAACAGACAGGCAGCCTGG - Intronic
1065922367 10:30403780-30403802 CGGGCAGCGCACAGGCAGGGCGG + Intergenic
1069042767 10:63712099-63712121 CAGGAAAAACACAGGCACCATGG - Intergenic
1070384993 10:75916383-75916405 CTGGCAAGAGAGAGGCAGCAGGG + Intronic
1073970654 10:109043013-109043035 TGGGAAACACTCAGGCATCACGG + Intergenic
1075786307 10:125052511-125052533 CAGACAACACAAAGGCAGGACGG - Intronic
1076199385 10:128546468-128546490 CCGGGAACACACAGGCACTAGGG + Intergenic
1076421744 10:130336798-130336820 TGGGGAAAATACAGGCAGCATGG - Intergenic
1076861474 10:133140147-133140169 GGGGCAAGACAGGGGCAGCACGG - Intergenic
1077034706 11:489033-489055 CGGGGCACCCACAGGCAGGAGGG - Intronic
1078121369 11:8513316-8513338 CGGGCTACACACAAGCATAAGGG - Intronic
1078530344 11:12132055-12132077 CGCACAACAGACAGGCAGCAAGG + Intronic
1078618232 11:12884389-12884411 CAGGCAACACACAGACAGCATGG - Intronic
1078946199 11:16071115-16071137 CAGGAAACACCCAGACAGCAGGG + Intronic
1078946222 11:16071257-16071279 CAGGAAACACCCAGACAGCAGGG + Intronic
1087417264 11:97872392-97872414 CTGGCAACAGCCATGCAGCATGG - Intergenic
1088020295 11:105111242-105111264 GGTGCAACACACAGAAAGCAAGG + Intergenic
1090402542 11:126458321-126458343 GGGGCACCACAAAGGGAGCAAGG + Intronic
1090574477 11:128086270-128086292 CGGGAAACACCCAGACAGCAGGG - Intergenic
1091111425 11:132972424-132972446 CAGGCAACACACAGTTACCAAGG + Intronic
1091192194 11:133705447-133705469 GGGGCAACAGACAGGCGGGAGGG - Intergenic
1091386813 12:101207-101229 TGGGCACGACACAGGCAGCAGGG - Intronic
1103609225 12:122111555-122111577 CGGCTAAGCCACAGGCAGCAGGG - Intronic
1104387906 12:128366614-128366636 CCAGCCTCACACAGGCAGCAGGG + Intronic
1106002459 13:25737128-25737150 GGGACAACACACAGGAAACACGG - Intronic
1107932214 13:45315704-45315726 CGGGCCACACTCAGGCTGGATGG - Intergenic
1113880408 13:113622367-113622389 GCGGCCACACAGAGGCAGCAAGG - Intronic
1113990335 14:16023358-16023380 CGGGAAACAAACAGTCAACATGG + Intergenic
1114616676 14:24072168-24072190 CGTGCATCCCACGGGCAGCATGG + Intronic
1117256503 14:53983671-53983693 GGGACAAAACACAAGCAGCATGG - Intergenic
1121278711 14:92685312-92685334 CTGGACACACACTGGCAGCAGGG - Intronic
1121688482 14:95857289-95857311 AGGACAACTCAGAGGCAGCAAGG + Intergenic
1121965201 14:98297106-98297128 CTGGCCACCCTCAGGCAGCATGG + Intergenic
1202836452 14_GL000009v2_random:80636-80658 AGTGCAACACACACACAGCAGGG + Intergenic
1123488373 15:20760954-20760976 CTGGGAACACACAGCCATCAGGG - Intergenic
1123544870 15:21330027-21330049 CTGGGAACACACAGCCATCAGGG - Intergenic
1123706616 15:22955452-22955474 GGGGCAGGACAGAGGCAGCATGG + Intronic
1124499785 15:30217413-30217435 CAGCCAACACCCAGGCACCATGG - Intergenic
1124743794 15:32321251-32321273 CAGCCAACACCCAGGCACCATGG + Intergenic
1125973303 15:43929737-43929759 CGGGGAAGAAACAGGCACCAGGG + Intronic
1129344229 15:74906573-74906595 CGGGCCACACTCACGCAGCTTGG + Exonic
1131597520 15:93813325-93813347 CAGGAAACACCCAGGCAGCAGGG + Intergenic
1202953216 15_KI270727v1_random:57298-57320 CTGGGAACACACAGCCATCAGGG - Intergenic
1133284576 16:4684565-4684587 CGGGGAACAGCAAGGCAGCAAGG + Intronic
1135981702 16:27152758-27152780 AGGGCAAGAGACAGGCAGCAGGG - Intergenic
1136091080 16:27920514-27920536 CGGGGAAAACACTTGCAGCAGGG - Intronic
1136909487 16:34134429-34134451 CGGGAAACAAACAGTCAACATGG + Intergenic
1136910273 16:34140056-34140078 CGGGAAACAAACAGTCAACAGGG + Intergenic
1137329642 16:47479589-47479611 CAGGCCATCCACAGGCAGCAAGG - Intronic
1137502601 16:49023084-49023106 CAGGCATTTCACAGGCAGCAGGG - Intergenic
1137592966 16:49705006-49705028 CGGGCAACAAAGAGGCTGGAAGG - Intronic
1137785991 16:51138310-51138332 CGGGCAGCACACAGGCCACGTGG + Intronic
1138576229 16:57908847-57908869 CAGGCAGCAGACAGCCAGCAAGG - Intronic
1140036228 16:71373213-71373235 TGGCCAACAGACACGCAGCAGGG - Intronic
1140235533 16:73155362-73155384 GGGGCAACTCCCAGACAGCAAGG + Intergenic
1141620928 16:85236088-85236110 CGGGAGCCACACAGGCAGCCAGG - Intergenic
1142215100 16:88826166-88826188 CGGGCTACAGACAGGGAACAGGG + Intronic
1142631702 17:1229823-1229845 CGGGCATCCCACAGCCAGCTCGG + Intergenic
1148548212 17:48532694-48532716 GGGGCAAGACACAGACTGCAGGG - Intergenic
1148874104 17:50676324-50676346 GGTGCAACACACGGGCAGCCTGG - Exonic
1150001415 17:61443187-61443209 CGGGCAATAAACAGGCAGACCGG - Intergenic
1150621658 17:66812312-66812334 CCGGCCCCACAGAGGCAGCAGGG + Intergenic
1152458692 17:80430284-80430306 TGGGCAAAGCACAGGCTGCAGGG - Intronic
1152525503 17:80886109-80886131 GGAGCCACACACAGCCAGCACGG - Intronic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152933122 17:83120468-83120490 AGGGGAGCGCACAGGCAGCACGG - Intergenic
1153515062 18:5895071-5895093 CGGGCGACACAAAGGAACCATGG + Exonic
1157404401 18:47410880-47410902 CGGGCCCCACACAGACAGGAGGG + Intergenic
1157792814 18:50547935-50547957 CGGGCAAAAGCCAGGCAGCGCGG - Intergenic
1158959241 18:62574847-62574869 TGGGTAACACGCCGGCAGCAAGG - Exonic
1160902941 19:1438261-1438283 AGGGCAAAACACAGGCTGCAGGG - Intergenic
1162231246 19:9268790-9268812 CGTGCACCACACAGGGAGGACGG - Intergenic
1164831119 19:31321578-31321600 CTGGCCACAATCAGGCAGCAAGG + Intronic
1165984578 19:39756952-39756974 AGGGAAACAGACAGTCAGCAGGG - Intergenic
1167463420 19:49638212-49638234 CGGGCAGGACCCAGGCAGGAAGG - Intronic
1167867136 19:52337393-52337415 AGGGCAAGAAACAGGCAGAATGG + Intronic
1202636187 1_KI270706v1_random:46729-46751 AGTGCAACACACACACAGCAGGG - Intergenic
925347356 2:3180225-3180247 AGGGAAACACCCAGGAAGCAGGG + Intergenic
927064513 2:19457798-19457820 AGGGCCACACACAGGAAGAAAGG - Intergenic
927565125 2:24105047-24105069 CTGGAAACACCCAGACAGCAGGG + Intronic
934508460 2:94916581-94916603 GGGGCAGCCCACAGGCATCAGGG - Intergenic
934708448 2:96500602-96500624 CGCGCAGCCCTCAGGCAGCACGG + Exonic
935225853 2:101052346-101052368 CTGGCAATACAGAGCCAGCAAGG + Intronic
936407771 2:112222410-112222432 CTGGAAACACCCAGACAGCAGGG - Intronic
939125890 2:138176995-138177017 GGGGCAGCACACAGAAAGCATGG + Intergenic
939494864 2:142915957-142915979 CGGGAAACACACAGGCATACTGG + Intronic
939865816 2:147471300-147471322 AAGGGAACACACAGGAAGCAAGG + Intergenic
945221379 2:207487990-207488012 CCGGGGACACACAGCCAGCAAGG + Intergenic
945761769 2:213923350-213923372 CAGGAAACACCCAGACAGCAGGG - Intronic
948229926 2:236342185-236342207 CGGGTGCCATACAGGCAGCAGGG - Intronic
948429285 2:237908999-237909021 CTGGCATCACACTGGCATCATGG + Intronic
948991579 2:241558545-241558567 CGGGGAACACCCAGGCGGCTGGG + Intergenic
1171151331 20:22828691-22828713 AGGGCAAAAAACAGACAGCAGGG - Intergenic
1171771544 20:29326316-29326338 CGGGAAACAAACAGTCAACACGG - Intergenic
1171813495 20:29763547-29763569 CGGGAAACAAACAGTCAACATGG - Intergenic
1171820878 20:29836690-29836712 CGGGAAACAAACAGTCAACATGG + Intergenic
1171896238 20:30812893-30812915 CGGGAAACAAACAGTCAACATGG - Intergenic
1171904952 20:30893155-30893177 CGGGAAACAAACAGTCAACATGG + Intergenic
1172647639 20:36481159-36481181 CAGGCTAGACACAGGCAGGATGG - Intronic
1173461528 20:43246952-43246974 CTGGGAAGACACAGGCAGTATGG + Intergenic
1175937379 20:62519982-62520004 CTGGCCACGCACAGGCAGCTGGG + Intergenic
1175943891 20:62550052-62550074 CGGGCATCTCCCAGGCTGCAGGG - Intergenic
1176103111 20:63373417-63373439 CGGGCAGCTCACAGCCGGCACGG - Intronic
1176289442 21:5036355-5036377 CGGGGACCTCACAGGCAGGACGG + Intronic
1176695695 21:9974797-9974819 CAGGCATCACATGGGCAGCAAGG + Intergenic
1179867788 21:44227232-44227254 CGGGGACCTCACAGGCAGGACGG - Intronic
1179988619 21:44934218-44934240 CTTGGAACACACAGGCAGCCAGG + Intronic
1180222368 21:46367181-46367203 GTGGAAACACACAGGCAGCGAGG - Intronic
1180316936 22:11284168-11284190 CGGGAAACAAACAGTCAACATGG - Intergenic
1180338383 22:11599340-11599362 CGGGAAACAAACAGTCAACATGG + Intergenic
1180339160 22:11604888-11604910 CGGGAAACAAACAGTCAACATGG + Intergenic
1180994305 22:19957603-19957625 CGGCCAGGACACAGGCAGCTGGG - Intronic
1182735433 22:32529509-32529531 CTGGCAAAACACAGGCGGGAGGG + Intronic
1182869346 22:33632589-33632611 GAGGCAACACAGAGGCAGGAAGG - Intronic
1183192915 22:36333094-36333116 TGGGACACACACAGGGAGCATGG + Intronic
1183495060 22:38138477-38138499 CGGGCAGCACTCAGGCAGGGAGG - Intronic
1183821408 22:40348867-40348889 CTGGCAGCCCACAGGCAGCTCGG - Intronic
1184283019 22:43449653-43449675 AGGGCCACACACATGCATCAGGG + Intronic
1184888638 22:47366156-47366178 AGGGAAACACACAGGCAGGCTGG + Intergenic
952958846 3:38577198-38577220 CGGGCAACACACAGGCAGCAAGG + Intronic
955472089 3:59296204-59296226 TGGGAAACACCCAGACAGCAGGG + Intergenic
959186407 3:103052592-103052614 AAGGAAACAAACAGGCAGCATGG - Intergenic
959533069 3:107455725-107455747 AGGACAACAAACAGGCAGCTTGG + Intergenic
962200837 3:133400058-133400080 TGGGCACCACAGAGGCAGAAGGG + Exonic
963051108 3:141144778-141144800 CAGGCAACACACAGGGAGTTGGG + Intronic
964336301 3:155658231-155658253 TGGGCACCACACAGGCAAGAGGG + Intronic
965686923 3:171313960-171313982 AGAGAAACACACAGGCAGGAAGG + Intronic
965779822 3:172273423-172273445 CGGGGAATATACAGGGAGCAGGG - Intronic
965784901 3:172325098-172325120 CTGGTCACACACAGGCAGCAGGG - Intronic
965818320 3:172659524-172659546 CGGGCCACTCACAGACACCAAGG - Intronic
966905883 3:184525673-184525695 CGGGCCACACACAGCCAGGGTGG + Intronic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
972568719 4:40291766-40291788 CGGGGAAGACACATGCAGGATGG - Intergenic
973365996 4:49210115-49210137 AGTGCAACACACACACAGCAGGG - Intergenic
973394602 4:49582336-49582358 AGTGCAACACACACACAGCAGGG + Intergenic
974905055 4:68045098-68045120 CGGGCCACTCACAGACACCAAGG + Intergenic
978727326 4:111984548-111984570 CAGACCACACCCAGGCAGCAAGG + Intergenic
980368316 4:131835030-131835052 CAGGCATCACATGGGCAGCAAGG + Intergenic
984256221 4:177392941-177392963 GGGGCAACCCACAGGCAGAATGG - Intergenic
985445697 4:190020249-190020271 CGGGAAACAAACAGTCAACATGG + Intergenic
1202763501 4_GL000008v2_random:132596-132618 AGTGCAACACACACACAGCAGGG - Intergenic
985588518 5:753045-753067 CAGGTTAAACACAGGCAGCAGGG - Intronic
985603185 5:845484-845506 CAGGTTAAACACAGGCAGCAGGG - Intronic
988710865 5:33773428-33773450 CAGGCCACAGACTGGCAGCAGGG - Intronic
992891878 5:81211220-81211242 TTGGGAATACACAGGCAGCATGG - Intronic
993321093 5:86468024-86468046 AGGGCAACAAACATCCAGCATGG - Intergenic
996142479 5:119929171-119929193 CAGGCAAAAAACAGACAGCATGG - Intergenic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
999130228 5:149277352-149277374 GAGGCAAGACACAGGCAGAATGG - Intronic
999198350 5:149798542-149798564 CTGGCTGCTCACAGGCAGCACGG - Intronic
1001561134 5:172669760-172669782 GCGGAAAGACACAGGCAGCACGG - Intronic
1002276728 5:178108769-178108791 CTGGCCACTCACAGACAGCATGG + Intergenic
1002431410 5:179206413-179206435 CGGGCTAGAGGCAGGCAGCAGGG - Intronic
1006068038 6:31476632-31476654 GGGGCACCACAGAGACAGCACGG + Intergenic
1006280525 6:33049582-33049604 CAGGCCACACACAGACACCAAGG - Intergenic
1006436180 6:34027193-34027215 AGGGGGACACACAGGCATCAGGG + Intronic
1008648921 6:53544425-53544447 AGGGCAAGACAAAGGCAGCGCGG + Intronic
1013978560 6:116103449-116103471 CGGGCACCATACAGACAGCAAGG - Intronic
1014132175 6:117846806-117846828 CTGGAAACACCCAGACAGCAGGG + Intergenic
1014754432 6:125287881-125287903 CAGGCAGCACACAGGCAGAGCGG + Intronic
1017156930 6:151330876-151330898 TGGGGAACACATAGCCAGCAGGG + Intronic
1017781852 6:157721574-157721596 CGGGCCACACAAAGGCAGCGAGG - Intronic
1019595578 7:1856882-1856904 CTGGGGACACACAGGCAGCGAGG - Intronic
1019737902 7:2659571-2659593 CGCGTAAGACACAGGCAGGAGGG + Intronic
1022136837 7:27457200-27457222 CACACAACACACAGGCAACAGGG + Intergenic
1023685511 7:42730478-42730500 TTGGCAATACACAGGCAGCAAGG - Intergenic
1024535565 7:50428349-50428371 AGGGCCACATCCAGGCAGCAGGG - Intergenic
1026876710 7:73883432-73883454 TGGGCAAGACCCAGGCAGCTGGG + Intergenic
1026926303 7:74196249-74196271 CACACAACACACAGGCAACAGGG - Exonic
1028519910 7:91718284-91718306 CTAGCATCACACAGGCAGGAAGG + Intronic
1028526062 7:91788286-91788308 CCAGCATCACACAGGTAGCAAGG - Intronic
1030509791 7:110470579-110470601 CTGGCAACATGCAGGAAGCATGG + Intergenic
1032390697 7:131553686-131553708 TGGGCAACAGAAAGGCAGCTTGG - Intronic
1034195625 7:149244848-149244870 GGGGCAAATCACAGGCAGCCAGG - Intronic
1034429322 7:151033331-151033353 CAGGCAACACCCAGCCAGCCAGG - Intronic
1034435455 7:151060899-151060921 CCAGCAACACACTGGGAGCATGG + Intronic
1035117918 7:156540223-156540245 AGGGCAACGCACAGGCGGCAGGG + Intergenic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1036710977 8:11078432-11078454 TGGGGAACACACAGGCAGAATGG - Intronic
1038620914 8:29142328-29142350 TGAGAAACACACAGGCAGCGGGG + Intronic
1046114319 8:109766781-109766803 GGGGCAATACACAGGCATAATGG - Intergenic
1046201122 8:110928976-110928998 CGGGCCACCCACAGACACCAAGG - Intergenic
1047219933 8:122911098-122911120 CGGTCTACACACACGCAGGATGG + Intronic
1049015879 8:139919762-139919784 TGGGCCACACACTGGTAGCATGG - Intronic
1049502340 8:142974183-142974205 AGGGCAGCCCACAGGCAGCTGGG + Intergenic
1049685706 8:143938521-143938543 AGGTGAGCACACAGGCAGCATGG + Intronic
1051693401 9:19741749-19741771 ATGTCATCACACAGGCAGCAAGG - Intronic
1053632678 9:39960754-39960776 CAGGCATCACATGGGCAGCAAGG + Intergenic
1053773079 9:41502779-41502801 CAGGCATCACATGGGCAGCAAGG - Intergenic
1054211210 9:62289943-62289965 CAGGCATCACATGGGCAGCAAGG - Intergenic
1054313771 9:63558902-63558924 CAGGCATCACATGGGCAGCAAGG + Intergenic
1056411610 9:86333922-86333944 AGGGAAACACAGAGGCAACAAGG - Intronic
1061806889 9:133141758-133141780 CGGTAAACACACAGGCAGAGGGG + Intronic
1062158507 9:135067153-135067175 CGGGGAAGACACACGCGGCAGGG + Intergenic
1062396849 9:136356041-136356063 CGGGACACACTCAGGCTGCAGGG + Intronic
1203364478 Un_KI270442v1:244551-244573 CGGGAAACAAACAGTCAACATGG - Intergenic
1203365240 Un_KI270442v1:250106-250128 CGGGAAACAAACAGTCAACATGG - Intergenic
1203376917 Un_KI270442v1:383959-383981 CGGGAAACAAACAGTCAACATGG + Intergenic
1203544256 Un_KI270743v1:117469-117491 AGTGCAACACACACACAGCAGGG - Intergenic
1186205107 X:7192201-7192223 CTGGGAACACACTGCCAGCATGG - Intergenic
1186506806 X:10100318-10100340 GGGGCTCCACACAGGGAGCAAGG + Intronic
1191897464 X:66008252-66008274 CGGGAAACAGCTAGGCAGCAGGG + Intergenic
1195215925 X:102702088-102702110 AGGGAAACCCAAAGGCAGCAGGG + Intergenic
1196907853 X:120455595-120455617 TGAGAAACAAACAGGCAGCAAGG + Intronic
1197809307 X:130427386-130427408 CTTGGAACACAGAGGCAGCATGG + Intergenic
1198319127 X:135501631-135501653 AGGGCAAAACAAAGCCAGCAAGG - Intergenic
1200398289 X:156003931-156003953 TGGGCCACTCACAGGCTGCAAGG - Intronic