ID: 952959181

View in Genome Browser
Species Human (GRCh38)
Location 3:38579165-38579187
Sequence TGGGCATCCCTGTCCTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952959181_952959193 28 Left 952959181 3:38579165-38579187 CCCTGTCAGGACAGGGATGCCCA 0: 1
1: 0
2: 1
3: 35
4: 243
Right 952959193 3:38579216-38579238 GCTGCCTGTGACAGTGGCTGTGG 0: 1
1: 0
2: 2
3: 48
4: 405
952959181_952959191 22 Left 952959181 3:38579165-38579187 CCCTGTCAGGACAGGGATGCCCA 0: 1
1: 0
2: 1
3: 35
4: 243
Right 952959191 3:38579210-38579232 TTCCACGCTGCCTGTGACAGTGG 0: 1
1: 0
2: 3
3: 8
4: 135
952959181_952959185 -3 Left 952959181 3:38579165-38579187 CCCTGTCAGGACAGGGATGCCCA 0: 1
1: 0
2: 1
3: 35
4: 243
Right 952959185 3:38579185-38579207 CCACCCTCCCCTCTGCAGACTGG 0: 1
1: 0
2: 5
3: 44
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952959181 Original CRISPR TGGGCATCCCTGTCCTGACA GGG (reversed) Intronic
900007458 1:72018-72040 TGGGCATCCCTCCCCTGGGAAGG + Intergenic
900342014 1:2193989-2194011 TGGGCACACCTGTCCTGGGAAGG + Exonic
900576340 1:3384279-3384301 TGGGCAGCCCAGCCCAGACAGGG - Intronic
900780106 1:4612376-4612398 TGGGCATTCCTGGGCTGCCAGGG + Intergenic
901436802 1:9251513-9251535 GGAGGGTCCCTGTCCTGACATGG + Intronic
901961075 1:12827090-12827112 TTGGCGGCCCTGTCCTGAAATGG - Intronic
901967668 1:12881695-12881717 TGGGCGGCCCTGTCCTGAAATGG - Intronic
901975470 1:12940825-12940847 TTGGCGGCCCTGTCCTGAAATGG - Intronic
901983069 1:13051959-13051981 TTGGCGGCCCTGTCCTGAAATGG - Intronic
901985948 1:13075377-13075399 TTGGCGGCCCTGTCCTGAAATGG + Intronic
901995861 1:13151390-13151412 TTGGCGGCCCTGTCCTGAAATGG - Intergenic
901999022 1:13176959-13176981 TTGGCGGCCCTGTCCTGAAATGG + Intergenic
902009705 1:13260940-13260962 TTGGCGGCCCTGTCCTGAAATGG + Intronic
904992129 1:34601561-34601583 GGGGCATCTCTGTGCTGACCAGG - Intergenic
905001348 1:34672139-34672161 TGGTCATCCTTGTCCTGTCAGGG - Intergenic
907111860 1:51934021-51934043 TGGCCATCCCTCTCCTCACTGGG + Intronic
907961460 1:59286610-59286632 TGGGCATCCTTGTCTTGTCACGG - Intergenic
909054735 1:70807371-70807393 TGGGCATCCCTGTGCTCTCAGGG - Intergenic
910289658 1:85588092-85588114 TGGGCATCTCTGCTGTGACAGGG - Intergenic
911475484 1:98367528-98367550 TGGGCATCCCTGTGCTCTCAGGG - Intergenic
912011309 1:104966903-104966925 AGGGCATCCCTGTCCTGTGCTGG + Intergenic
917176544 1:172242178-172242200 TGGGCTTCCCTGTCCCTACCAGG - Intronic
918014253 1:180617694-180617716 TGTGCATCTCTGTCTTCACATGG + Intergenic
918116470 1:181502412-181502434 TGGGCTGCCATGTCCTGCCAGGG + Intronic
919087821 1:192942337-192942359 TGGACAACTCTGGCCTGACATGG - Intergenic
919249252 1:195030981-195031003 TAGGCATCCCTGTGCTCTCAGGG - Intergenic
919650501 1:200144362-200144384 TGGGCAACAGTGTGCTGACATGG - Intronic
920036479 1:203068881-203068903 TGCGCATCCCCGTCCTGCCCTGG + Intronic
920378661 1:205523138-205523160 TGGGCAGCCGGGTCCTGAGATGG - Exonic
921049302 1:211499717-211499739 TGGGCTTCCCTGGCCTCAGAGGG - Intergenic
923435761 1:233966310-233966332 AGGGTATCCCTGTCCTGATTAGG - Intronic
1063793180 10:9478501-9478523 TGGTCATCTCTTTCCTGCCAGGG - Intergenic
1064830914 10:19465267-19465289 TGGGCATCCTTGTCTTGTTACGG + Intronic
1065806210 10:29395505-29395527 TGGGCATCTGTGTCTGGACAAGG - Intergenic
1066653370 10:37679843-37679865 TGGGCATCCCTGTCCTTTCCTGG + Intergenic
1067279042 10:44857539-44857561 TGAGCATCCCTGTCCACACCCGG - Intergenic
1069646401 10:70001598-70001620 TTGGCTTCCCTTTCCTGGCATGG - Intergenic
1069823712 10:71242671-71242693 TGGGCACTCCTGGCCTGCCATGG - Intronic
1071481753 10:86069934-86069956 TCGGCATCCCTGTCTTCCCATGG - Intronic
1073285173 10:102383097-102383119 TGGGCACACCTGTGATGACAAGG - Intergenic
1076280786 10:129244280-129244302 CGGACATCCCTGTGCTGACGTGG - Intergenic
1076825180 10:132963594-132963616 GGGGCATCCCAGCCCTCACAGGG + Intergenic
1078062397 11:8056446-8056468 TGCGCATGCTTGTGCTGACAGGG + Intronic
1078345635 11:10545163-10545185 TGGGCATCCTTGTGCTCTCAGGG - Intergenic
1080329229 11:31115996-31116018 TGGGTATCTCAGTCCTGAGAGGG + Intronic
1083632928 11:64104943-64104965 GGGGCTTCCCTGTCCTGCCCAGG - Intronic
1085377121 11:76074952-76074974 TGGGAACCCCTGTTCTGCCAAGG + Intronic
1085435070 11:76493030-76493052 TGGGCATCCGTGTGCTCTCAGGG + Intronic
1085777290 11:79378345-79378367 TGGGGATCACGCTCCTGACAGGG + Intronic
1085970717 11:81587576-81587598 TGGGCCTTTCTGTCCTTACAGGG - Intergenic
1087131301 11:94671626-94671648 TGGGCATCTCTGTGCTCTCAGGG + Intergenic
1087265495 11:96056182-96056204 AGGGCATCCCTGCCCCCACAGGG + Intronic
1088244447 11:107803455-107803477 CAGGCATCGCTGTCCTGGCAGGG - Intronic
1089335479 11:117720118-117720140 TGGGCATGCCAGTGCTGACTCGG - Intronic
1091786267 12:3244991-3245013 TGGGCATCCCGGTCTTTCCAAGG + Intronic
1092310905 12:7351509-7351531 TGGGAATCCCTAATCTGACAGGG - Intronic
1092852844 12:12646649-12646671 TCGGCAACCCTTTCCTGAGAAGG + Intergenic
1095749785 12:45697353-45697375 TGGGCATCCCTGCACTCTCAGGG - Intergenic
1095951001 12:47781924-47781946 TGGGCATCCTTGCCCTGGCTGGG - Exonic
1099963624 12:89421337-89421359 TGGGCATCCCAGTTCTTAAAAGG - Intronic
1107841035 13:44458617-44458639 TGGGCATCCCTGTGCTCTCGGGG + Intronic
1109201034 13:59431257-59431279 TGGGCATCCTTGTCCTGCTCTGG + Intergenic
1109478776 13:62919820-62919842 TGGACATCCCTGTGCTCTCAGGG - Intergenic
1111354537 13:87080580-87080602 TGGGCATCCCTGCGCTCTCAGGG - Intergenic
1111595282 13:90403619-90403641 TGGGCATCCCTGTACTCTCAGGG + Intergenic
1112331379 13:98479487-98479509 TGGGCATCCCTCAGCTGGCAGGG - Intronic
1112991096 13:105514791-105514813 TGTGCATCCCTGGACTTACAGGG - Intergenic
1116019201 14:39441054-39441076 TGGGCATCCCTGTGCTCTCTGGG + Intergenic
1116151351 14:41145711-41145733 TGGGCATCCCTGTGTTCTCAGGG - Intergenic
1116317075 14:43410731-43410753 TGGGCATCCCTGTACTCTCAGGG - Intergenic
1119257275 14:73209117-73209139 TGGGCATCCCTGTGCTCTCAGGG - Intronic
1121224126 14:92308805-92308827 TGGCCACCCCTGACCTGAGAAGG + Intergenic
1122202635 14:100131859-100131881 TGGGCAGACCTGTCCTGAGATGG + Intronic
1122328913 14:100899895-100899917 TGGGTCTCCCTGCCCTGAAAGGG - Intergenic
1122902536 14:104787743-104787765 AGGGCATCCCTGCCCAGAGAGGG + Intronic
1124125279 15:26933601-26933623 TGGCCATGACTGGCCTGACAGGG - Intronic
1128340807 15:66821400-66821422 TGGGCCTCCATTCCCTGACAGGG + Intergenic
1128847751 15:70916797-70916819 TGGGCATCCCTGTGCTGTTGGGG + Intronic
1129718456 15:77865093-77865115 TGGGCTTCCCTGCCCTGAACAGG - Intergenic
1130460466 15:84155773-84155795 TGGGCTTCCCTGCCCTGAGCAGG + Intergenic
1132106764 15:99068414-99068436 TGGGCATGTCTGTCTTAACAAGG + Intergenic
1132446092 15:101920110-101920132 TGGGCATCCCTCCCCTGGGAAGG - Intergenic
1132527429 16:424721-424743 TGGGTGTCCCTGTCCTCAGAGGG - Intergenic
1133981935 16:10639487-10639509 TGGGCATCCATGTCCTTAAATGG + Intronic
1134254481 16:12600376-12600398 CGGGCATCCCTGTGCTCTCAGGG + Intergenic
1136266432 16:29122505-29122527 TGAGCATCTCTGTTCTGGCACGG + Intergenic
1136392611 16:29974737-29974759 TGGGCTTCCCCATCCTGAGAGGG - Intronic
1136716293 16:32286424-32286446 GGGGCATCCCTGCCCTCCCAGGG + Intergenic
1136834679 16:33492702-33492724 GGGGCATCCCTGCCCTCCCAGGG + Intergenic
1138117780 16:54374058-54374080 TCGGCACCCCTCTCCTGCCAGGG - Intergenic
1139660658 16:68418694-68418716 TGGGCATCCCTGTTCTCATATGG - Intronic
1140890340 16:79279517-79279539 TGGGCATCTCTGTTCTGTCCTGG - Intergenic
1140980743 16:80106571-80106593 TCGGCATCAGTGTCCTGAAAGGG + Intergenic
1141034828 16:80618009-80618031 TGGGCCTCTCTGTGCTGTCAGGG + Intronic
1141429890 16:83966036-83966058 TGGTCATCTCTGTCCTCTCAGGG - Exonic
1142055280 16:87990460-87990482 TGAGCATCTCTGTTCTGGCACGG + Intronic
1142146513 16:88495095-88495117 TGGGCATCCCACTCCTGCCTCGG + Intronic
1203010124 16_KI270728v1_random:231330-231352 GGGGCATCCCTGCCCTCCCAGGG - Intergenic
1203144848 16_KI270728v1_random:1792990-1793012 GGGGCATCCCTGCCCTCCCAGGG + Intergenic
1143117926 17:4591125-4591147 GAGGCATCCTTATCCTGACACGG + Intronic
1143209382 17:5172727-5172749 TGGTCTTCCCTTTCCTGGCAAGG + Intronic
1144618864 17:16802181-16802203 TGGTCTTCCCTTTCCTGGCAAGG + Intronic
1144769543 17:17752121-17752143 TGGGCAGCCCTCTCCCCACAGGG - Intronic
1144893842 17:18513513-18513535 TGGTCTTCCCTTTCCTGGCAAGG - Intergenic
1145138386 17:20430760-20430782 TGGTCTTCCCTTTCCTGGCAAGG + Intergenic
1149870760 17:60179484-60179506 TGGTCTTCCCTTTCCTGGCAAGG - Intronic
1150698169 17:67423851-67423873 TGGGCATCTCTGTCCTCATTTGG + Intronic
1151577094 17:74958351-74958373 TGGACATCCCAGTCTTCACAGGG - Exonic
1152286525 17:79416104-79416126 TGGGCAGCCCTGCCCTGCCTGGG - Intronic
1152784661 17:82241521-82241543 TGGGGTTCCCTGCCCTGAGAGGG - Intronic
1153472987 18:5467930-5467952 TGGGCATCCCTGCACTCTCAGGG + Intronic
1154218028 18:12429760-12429782 TGGCCAGGCCTGTCCTGACAGGG + Intronic
1154357631 18:13633768-13633790 AGGGCATCCCTGTGCTCTCAGGG - Intronic
1155215657 18:23641297-23641319 TGGGCATCCCTGTGCTCTCTGGG + Intronic
1156373161 18:36489340-36489362 AGGGCATCCCTCTCCTGAGATGG - Intronic
1158247760 18:55451356-55451378 CTGGCATCCCTGTCCTCACCTGG + Intronic
1158515465 18:58126927-58126949 TGGGCAGCCCTGTCCTCACCTGG + Intronic
1161045430 19:2131892-2131914 TGGGAAGCACTGTCCTCACATGG - Intronic
1166761063 19:45224725-45224747 AGCGCTTCCCTGTCCTGGCATGG + Intronic
1168706435 19:58472918-58472940 TGGGCATCCCTCTCCTGAGTCGG - Exonic
925250156 2:2427028-2427050 TAGGCATCCTTGTCCTGAAAAGG - Intergenic
925732116 2:6926612-6926634 TGGGAATCCCAGTCCTGTCCTGG + Intronic
928182795 2:29081160-29081182 CGGGCATCCCTGTACTCTCAGGG - Intergenic
928427854 2:31193381-31193403 TGGGCATCCCAGCCCTCTCATGG + Intronic
929847247 2:45542366-45542388 TGGGCATCCCTGCACTCTCAGGG - Intronic
931989154 2:67772114-67772136 TGGGCATCTCTGTCCTTCAAAGG - Intergenic
932493830 2:72137013-72137035 CTGGCATCCCTGTCCCGCCATGG - Intronic
933420749 2:82042881-82042903 TGAGCATCCCTGTGCAGTCAGGG + Intergenic
936908643 2:117567228-117567250 AGGGCATCCCTGTCTGGGCAAGG + Intergenic
937054724 2:118924535-118924557 TGGGTATCCCTTGCCTGAAATGG - Intergenic
937167693 2:119836648-119836670 TGGGCATCCCTGTGCTCTCGCGG + Intronic
937370929 2:121296678-121296700 GGGGCATCCCTGTACTCTCAGGG - Intergenic
937376616 2:121340756-121340778 TGGGCCTCCTTGTACTGACTGGG + Exonic
937911616 2:127078305-127078327 TGTGGGTCTCTGTCCTGACATGG + Intronic
937986809 2:127641687-127641709 TGGACAGCCCTGTGCAGACACGG - Intronic
938068030 2:128292388-128292410 TGGGCGTCCCTGCCCTGAGAAGG - Intronic
939000033 2:136724012-136724034 TGGGCATCCCTGTCTTGTTCCGG + Intergenic
939801775 2:146720287-146720309 TGGGCATCCCTGTGCTCTCAGGG + Intergenic
940582715 2:155601404-155601426 TGGGCATCCCTGTCCTCTCAGGG - Intergenic
940957044 2:159739136-159739158 TGGGTATCCCTGTGCTCTCAGGG - Intronic
943073470 2:183168923-183168945 TGGGCATCGTTGTCTTGATACGG + Intergenic
945506957 2:210653334-210653356 AGGGCATCCCGACCCTGACATGG + Intronic
1168788844 20:562627-562649 TGGCCATCCCTGGCCTGGCTGGG + Intergenic
1170390264 20:15865732-15865754 TGGGCATCCCTCACCTGTCTGGG - Intronic
1170725866 20:18926010-18926032 TGGGCATTCCTCTTCTGACGAGG - Intergenic
1171285914 20:23938010-23938032 TGGGCATCCCTGTGCTCTCAGGG + Intergenic
1173217303 20:41096946-41096968 AGGTCATCCCTGTCCTGAGCAGG + Intronic
1174788285 20:53453787-53453809 TGGGCATCCCTCTCCTACCCTGG - Intronic
1175514306 20:59559257-59559279 TGGGCCACCATGTCCTGGCAGGG + Intergenic
1178947279 21:36959111-36959133 TGGGCATCCCTGCACTCTCAGGG + Intronic
1179614508 21:42573108-42573130 TGAGCATCCCTGTCCTGCACTGG + Intronic
1180796295 22:18607395-18607417 AGGGCAGCCTTTTCCTGACACGG + Exonic
1181225427 22:21387876-21387898 AGGGCAGCCTTTTCCTGACACGG - Exonic
1181253206 22:21546937-21546959 AGGGCAGCCTTTTCCTGACACGG + Exonic
1181369043 22:22401831-22401853 TGGGCATCCTTGTCCTGTATGGG + Intergenic
1182394944 22:30028516-30028538 TGGGCATCCCTCCCATCACATGG + Intronic
1183605168 22:38863754-38863776 TGAGCCTCCCTGGCCTGAAAGGG - Exonic
1184301483 22:43563271-43563293 TTGGCCTCCCTGTCCTCACTGGG + Intronic
1184614855 22:45631117-45631139 TGTGCATCCCTCCTCTGACACGG - Intergenic
1185034146 22:48462492-48462514 GAGGCATCCCTGCCATGACAGGG - Intergenic
1185203213 22:49521218-49521240 TGGGCTCCCCAGTCCTCACAAGG - Intronic
949331621 3:2929941-2929963 TGGGGATCCCTGCCCTGGCATGG - Intronic
949867831 3:8561116-8561138 TGTGCTTCCCTGTCTTCACATGG + Intronic
952959181 3:38579165-38579187 TGGGCATCCCTGTCCTGACAGGG - Intronic
953392438 3:42541244-42541266 TGGCCATCCCTGGCCTGATTGGG - Intergenic
953748287 3:45591570-45591592 TGGGCATCCCTGTGCTCCCGGGG - Intronic
954108559 3:48421936-48421958 TGGGCATCAGTGCCCTGCCAGGG - Intronic
955028144 3:55189971-55189993 AGGGGATCCCTTTCGTGACAAGG - Intergenic
955115922 3:56001682-56001704 TGGTCCTACCTATCCTGACAGGG + Intronic
956259463 3:67322739-67322761 ATGGTATCCCTGTCCTGACCTGG - Intergenic
956697861 3:71933909-71933931 TGGGCATCCGTGTTTTCACATGG - Intergenic
957085523 3:75672756-75672778 TGAGCATACCTGTCCTGAGCCGG - Intergenic
957339175 3:78871158-78871180 TGGGCATCAGTGTCTTCACATGG - Intronic
957459310 3:80496815-80496837 TGGGCAGCAATGTCCGGACAAGG + Intergenic
957802626 3:85105128-85105150 AGGGCATCCCTGTCATCAGAGGG + Intronic
959476665 3:106820989-106821011 TGGGCATCCCTGTGCTCTCGGGG + Intergenic
960885993 3:122395195-122395217 TGGACATCCTTGTCATGTCATGG - Intronic
961409249 3:126706477-126706499 TACCCATACCTGTCCTGACAGGG + Intronic
961471012 3:127112656-127112678 TGAGCATCCATGTTCTGAGAAGG + Intergenic
962603614 3:137013778-137013800 TGGCTCTCCCTGTCCTGTCAAGG + Intergenic
964927366 3:161975368-161975390 TGGGCATCCCTGCACTTTCAGGG - Intergenic
965613069 3:170565165-170565187 TAGGAATCCCTGGCCTGGCAGGG + Intronic
966619470 3:181947964-181947986 TAGGCCTCCCTGTCCAGAAAGGG - Intergenic
966674328 3:182568956-182568978 TGGCCTTCCCTGTCCTCCCAGGG - Intergenic
968576379 4:1368113-1368135 TGCGCAGGCCTGTCCTGACCTGG + Intronic
968607753 4:1543501-1543523 TGGGCTGCCCTGACCAGACAGGG + Intergenic
969179134 4:5423974-5423996 TGGGCATCCCTGTGCTCTCAGGG + Intronic
969406048 4:6992522-6992544 TGGGCATCCACATCCTGCCATGG + Intronic
972975243 4:44626461-44626483 TGGACCTTCCTGTCCTGAAAAGG + Intronic
973284909 4:48403956-48403978 TGTGCAACCCTGCCCTGACTTGG - Intronic
976716801 4:88131593-88131615 TTGGTATCACTGTCCTTACAAGG + Intronic
976734610 4:88296923-88296945 TGGGCATCCCTGTGCTCTTAGGG - Intergenic
978466837 4:109017111-109017133 TGGGCACCCATGTCTGGACAAGG - Intronic
981637455 4:146897392-146897414 GGGGCCTCTCTCTCCTGACAGGG + Intronic
982714064 4:158788320-158788342 TGGTCATCCCTGTCCTCAGAGGG - Intronic
983069612 4:163253564-163253586 TGGGCACCCATGTCTGGACAAGG + Intergenic
986081691 5:4401039-4401061 TGGCCATCACAGTGCTGACAAGG - Intergenic
988645473 5:33090813-33090835 TGGGCATCCTTGTCTTGTTATGG + Intergenic
988939744 5:36131419-36131441 TGGGCATCCTTGTCTTGTTATGG - Intronic
989730555 5:44642273-44642295 TGGGCATCCCTGCACTCTCAGGG - Intergenic
989821589 5:45800143-45800165 TGGGCATCCCTGTTCTCTCAGGG + Intergenic
990902121 5:60763273-60763295 CTGGCATCCCCTTCCTGACACGG + Intronic
991023736 5:62007965-62007987 TGGGGAGCCCTGTCCTGCTATGG + Intergenic
991039762 5:62162992-62163014 CGGGCATCCCTGTGCTTTCAGGG - Intergenic
991359409 5:65803620-65803642 TGGGCATCCCTGTACTCTTAGGG - Intronic
991497327 5:67239421-67239443 TGGGAACCCCTCCCCTGACAAGG - Intergenic
992197597 5:74355150-74355172 AGGGCATCCATGTCTGGACAGGG + Intergenic
996176661 5:120368167-120368189 TGGGCATCCCTGTGCTCTCTGGG + Intergenic
996938887 5:128980059-128980081 TGGGAATCCAGGTCCTTACATGG - Intronic
997285213 5:132673005-132673027 TGGGCATTCCTGGCCAGGCATGG + Intergenic
997700578 5:135895751-135895773 TGGACACCCCTGGCCTGCCACGG + Exonic
1002599330 5:180345389-180345411 TGTGCATCCCTGTCCTTCCCTGG - Intronic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1004304343 6:14487072-14487094 CGGGCATCCCTGTGCTCTCAAGG + Intergenic
1005594819 6:27368859-27368881 TGGGCACCCATGTCTGGACAAGG - Intergenic
1006902706 6:37513308-37513330 TGGGCATCCTTCTCCTGGAATGG + Intergenic
1007702827 6:43774415-43774437 TGGGGTTCCCTGTCCTCTCAGGG + Intronic
1008351840 6:50500183-50500205 TTGGTATCCCTGCCCTCACATGG + Intergenic
1010079876 6:71848342-71848364 TGAGCATCTCTGCCCAGACAGGG - Intergenic
1010138432 6:72583235-72583257 AGGGCATCCCTGTCCTGTGCCGG + Intergenic
1011336640 6:86268590-86268612 AGGGCATCCCTGTCTTGTCCTGG + Intergenic
1011831152 6:91373293-91373315 AGGGCATCCTTGTCCTGTGATGG + Intergenic
1017965936 6:159265974-159265996 TGGGCCTTCCTTTCCTTACAGGG - Intronic
1018112370 6:160547853-160547875 TGGGCAGCCCATTCCTGGCATGG + Exonic
1018130900 6:160731807-160731829 TGGGCAGCCCAGTCCTGGCATGG - Exonic
1018635312 6:165854940-165854962 TGGGCCTCCCTCTCCAGGCAGGG - Intronic
1019659125 7:2214118-2214140 TGAGCCTCACAGTCCTGACAAGG + Intronic
1020260738 7:6529521-6529543 TGGGCAGCCCTTTCCTTACTTGG + Intronic
1020343107 7:7133899-7133921 TAGACATCACTGTCTTGACATGG - Intergenic
1021259273 7:18433326-18433348 TGGGCATCCCTGTCTTGGCTTGG - Intronic
1021677566 7:23097010-23097032 TGGGCATCCCTGTGCTCTCAGGG + Intergenic
1023334227 7:39151721-39151743 GGGGCATCATTGCCCTGACATGG - Intronic
1023622223 7:42085667-42085689 TGGGTTTCCCTGCCCTGGCAGGG - Intronic
1026373398 7:69724835-69724857 TGGGGATCCATGTCCAGAGAGGG + Intronic
1027682089 7:81233627-81233649 CGGGCATCCCTGTGCTCTCAGGG - Intergenic
1029657393 7:101936293-101936315 TGGACTTCCCCATCCTGACAAGG + Intronic
1030722043 7:112882057-112882079 TGGGCATCCATGTCTGAACAAGG - Intronic
1031859005 7:126957458-126957480 TGGGCATCCCTGCTCTCTCAGGG + Intronic
1032326699 7:130935773-130935795 AGAGCTTCCCTGACCTGACAAGG + Intergenic
1032487625 7:132299925-132299947 TGGGCAGCCCTCTCCTAACAAGG + Intronic
1033549496 7:142433867-142433889 GGGACATCCCTGTCCTCTCATGG - Intergenic
1034921556 7:155087587-155087609 TGGGCACCAATGTCCTGACAGGG - Intergenic
1035142033 7:156772470-156772492 TGGGCATCCTTGTCTTGTTACGG - Intronic
1036430279 8:8683368-8683390 TGGGCTTCTCTGTAATGACATGG - Intergenic
1037323399 8:17664970-17664992 TGGGCCTCCGTGTCCTGATATGG + Intronic
1038159487 8:25023153-25023175 TTGGCATCTCTGTGCTGTCAGGG + Intergenic
1039165424 8:34674260-34674282 TTGTCAACCCTGTCCTAACATGG - Intergenic
1039887454 8:41663309-41663331 TGAGCATCCCTGGCCTACCATGG - Intronic
1041274311 8:56142068-56142090 TGGGCATCCCTGTACTCTCTGGG + Intergenic
1042624998 8:70748305-70748327 TGGGCATCCCTGCACTCGCAGGG + Intronic
1042856522 8:73273269-73273291 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1044525089 8:93242206-93242228 TGGGCATCCCTGTGCTCTCAGGG - Intergenic
1044588697 8:93892604-93892626 TAGGCATCCCTTCACTGACAAGG + Intronic
1049021879 8:139962744-139962766 TGGGCCTCCCTGAGCTGACAGGG - Intronic
1050589796 9:7149395-7149417 CGGGCATCCCTGTGCTCTCAGGG - Intergenic
1050607589 9:7317511-7317533 TGTACATGCCTGCCCTGACATGG - Intergenic
1050941882 9:11471234-11471256 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1051447692 9:17158103-17158125 TGGGTATCCCTTATCTGACATGG - Intronic
1055435619 9:76289185-76289207 ACGGCATCCCCGTCCTGACGAGG + Intronic
1055987204 9:82063718-82063740 TGGGCATCCCTGTGGAGACTAGG + Intergenic
1061809764 9:133155423-133155445 TGGGCCTCCCTTTCCTCATATGG + Intronic
1185945622 X:4372568-4372590 TGTGCATCTCTGTCTTCACATGG + Intergenic
1186737965 X:12486095-12486117 TGGGGCTCCCTGGCCTGGCAGGG - Intronic
1187467038 X:19537013-19537035 TGGCCATTTCTGTCCTGCCAGGG - Intronic
1188727872 X:33607405-33607427 TGGGCAGCCCTGTACTCTCAGGG - Intergenic
1190000532 X:46682297-46682319 CAGCCATCCTTGTCCTGACATGG - Intronic
1190756876 X:53408973-53408995 TTGGCAACCCTGTCCTTACAGGG + Intronic
1191681280 X:63842710-63842732 AGGGCATCCCTGTCTTGTCCTGG - Intergenic
1193347020 X:80415360-80415382 TGGGCATACCTGTCCTGTTCTGG + Intronic
1195709302 X:107761251-107761273 TGGGCTTCTCTGCCCTCACAAGG - Intronic
1195970857 X:110471645-110471667 AGAGCATCACTGTCCTGTCAAGG - Intergenic
1196005536 X:110833293-110833315 AGGGCATCCCTGTCTTGCCCAGG + Intergenic
1196715484 X:118807010-118807032 GGGGCATCCCTGTCCTCAGAAGG + Intergenic
1197422278 X:126253070-126253092 TGGGCATCTTTGTCATGAAATGG + Intergenic
1198006415 X:132498921-132498943 AGGACATCCCTGTCCTGTCTTGG - Intergenic
1198189383 X:134287672-134287694 TGGGCATCCCTGTGCTCTCAGGG + Intergenic
1199951059 X:152706520-152706542 TGGGCATTCCTGGCCTGTCTCGG - Intergenic
1199958625 X:152761941-152761963 TGGGCATTCCTGGCCTGTCTCGG + Intergenic
1202378786 Y:24259407-24259429 TGGGCTTCCCTGCCCTGAGCAGG - Intergenic
1202491996 Y:25410714-25410736 TGGGCTTCCCTGCCCTGAGCAGG + Intergenic