ID: 952962003

View in Genome Browser
Species Human (GRCh38)
Location 3:38598186-38598208
Sequence AAGATGGAGGTGGGGAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 1, 2: 6, 3: 67, 4: 570}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952961996_952962003 -5 Left 952961996 3:38598168-38598190 CCATAGGGACAGGAAACAAAGAT 0: 1
1: 0
2: 1
3: 23
4: 273
Right 952962003 3:38598186-38598208 AAGATGGAGGTGGGGAAAATGGG 0: 1
1: 1
2: 6
3: 67
4: 570
952961991_952962003 24 Left 952961991 3:38598139-38598161 CCTTAATCTGGAAATATGAGAGA 0: 1
1: 0
2: 0
3: 21
4: 245
Right 952962003 3:38598186-38598208 AAGATGGAGGTGGGGAAAATGGG 0: 1
1: 1
2: 6
3: 67
4: 570

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952962003 Original CRISPR AAGATGGAGGTGGGGAAAAT GGG Intronic
900871071 1:5303712-5303734 GGGCTGGAGGAGGGGAAAATGGG + Intergenic
901169018 1:7241686-7241708 GAGTTGGGGGTGGAGAAAATAGG + Intronic
901829029 1:11880894-11880916 AAGATGGAAGGGGGGAAAGATGG - Intergenic
901850857 1:12014355-12014377 ATGATGGAGGTGAGGAAACTGGG - Intergenic
902097837 1:13961093-13961115 AAAAGGGAGGTGGGAAAAAGGGG - Intergenic
903162226 1:21497254-21497276 AACAAGGAGGAGGAGAAAATGGG + Intergenic
903192330 1:21663712-21663734 AAGGTGGAGGTGGGGCAGATGGG - Intronic
903382725 1:22908171-22908193 AAGATGGAGGCAGGGAACACCGG + Intronic
903684441 1:25120509-25120531 CAGAAGGAGGAGGGGAAATTGGG - Intergenic
903976170 1:27151745-27151767 AAGGTGAAGCTGGGAAAAATGGG + Intronic
904385672 1:30140572-30140594 AGGATGGTGGTGGGGAGGATGGG - Intergenic
904696702 1:32335479-32335501 AAGCGGGAGGCTGGGAAAATAGG - Intronic
904756516 1:32771366-32771388 AAGATGGGGGTGGGGAAGGTGGG - Exonic
905211623 1:36378254-36378276 AGGATGGAGGAAGGGAACATGGG + Intronic
905750398 1:40457572-40457594 AAGATGGAAGTGTGGGAAAAGGG - Intronic
905936391 1:41827556-41827578 AGGATGGGGGAGGGGAAAGTGGG - Intronic
906220166 1:44072056-44072078 ATGATGGAGGTGGTGAGAATTGG + Intergenic
909356044 1:74711320-74711342 AAGAAAGCGGTGAGGAAAATGGG + Intronic
909785120 1:79601823-79601845 AGCAGGGAGGTCGGGAAAATGGG + Intergenic
909969617 1:81966019-81966041 ATAAAGGAGGTGGGGAAAAAAGG - Intronic
910217665 1:84858584-84858606 AAGATGGAAGTGAGGAAACCTGG + Intronic
910403135 1:86856729-86856751 AAGATGGGGGTGGGGGATAGTGG + Intergenic
910574947 1:88750782-88750804 AGGTTGAAGGTGGGGAAAAAAGG - Intronic
910589405 1:88913498-88913520 TAAATGGTGCTGGGGAAAATTGG - Intergenic
911399354 1:97355573-97355595 AAGCTCGGGGTGGGGAGAATAGG - Intronic
911559112 1:99382432-99382454 AAGATGAAGGTGGAGGAATTGGG - Intergenic
912187982 1:107303633-107303655 AAAATGAAGGCAGGGAAAATGGG - Intronic
912468557 1:109890937-109890959 AAGGGGGAGCTGGGGAAAGTTGG - Intergenic
913183748 1:116347445-116347467 AAGTTGGAGGAGGAGACAATGGG + Intergenic
913352256 1:117874794-117874816 CAGATGGAAGTGGGGAACTTAGG + Intronic
914439059 1:147687096-147687118 AAGATGGAGGTGGGGCCTAATGG + Intergenic
914513294 1:148353007-148353029 TGGAGGGAGCTGGGGAAAATGGG + Intergenic
915170603 1:153974551-153974573 AAGAAGAAGATGGGGAAAAGGGG + Exonic
915245941 1:154556527-154556549 AAGGGAGAGGTGGGGAGAATTGG - Intronic
917134335 1:171774725-171774747 AACAGGAAGGAGGGGAAAATAGG + Intergenic
917433345 1:174994414-174994436 GAGATGGAGGTAGGAAGAATGGG - Intronic
917458339 1:175205091-175205113 GAAATGGGGGTGGGGAAAGTAGG + Intergenic
917595311 1:176523248-176523270 AAAGTGGAGGTAGGGAAAGTGGG - Intronic
917610094 1:176680917-176680939 AATAAGGAGATGGGGAAAAGAGG + Intronic
918019973 1:180677981-180678003 AACCTGGAGGTGGGGATCATGGG - Intronic
918088051 1:181262263-181262285 GGGCTGGGGGTGGGGAAAATAGG - Intergenic
919154035 1:193738276-193738298 AAAATGCATGTGGAGAAAATTGG + Intergenic
919360749 1:196591083-196591105 ATGTTGGAGGTGGGGCTAATGGG + Intronic
919858189 1:201719901-201719923 GAGATGGGGGTGGGGAACAGTGG - Intronic
920983337 1:210859494-210859516 AAGATGGAGATGATGAAGATTGG - Intronic
920992011 1:210948540-210948562 TAGATGGAGGTGGGGCACAGTGG + Intronic
921588152 1:216973010-216973032 GACATGGAGGTGGGGAGAAGTGG - Intronic
922057036 1:222051226-222051248 AAGATGTAGGCTGGGAAACTAGG - Intergenic
922228477 1:223665829-223665851 AAGAAGAAGGTGGGGCAGATTGG - Intergenic
923374595 1:233348133-233348155 AAGGGGGAGTTGGGGACAATAGG - Intronic
923912609 1:238465426-238465448 AGGCTGGGGGTGGGGAGAATAGG - Intergenic
924785795 1:247197993-247198015 AGGCTGGAGTTAGGGAAAATTGG + Intergenic
924818205 1:247461604-247461626 TAGATGGAAGTGGTGAAAAATGG + Intergenic
1063083746 10:2793746-2793768 AAAATGGAGGGAGGGAAAAGGGG - Intergenic
1063286503 10:4694391-4694413 AAGATTGAAGGGGTGAAAATGGG - Intergenic
1063470944 10:6284732-6284754 GAGATGGAGGAGAGGGAAATTGG - Intergenic
1063499826 10:6543420-6543442 AAGGTGGCGTTGGGGAAAAAAGG + Intronic
1063917865 10:10902912-10902934 AAGAGGGAGGGAGGGAAAAGCGG + Intergenic
1063999240 10:11649613-11649635 GAGATGGAGTTGGGGACACTTGG - Intergenic
1064290536 10:14030092-14030114 GAGCTGGAGGAGGGGGAAATGGG + Intronic
1064587355 10:16852115-16852137 AAGATGGAGGGAGGGAAAGATGG - Intronic
1064972142 10:21076894-21076916 AAGATGACGGAGGGGGAAATGGG + Intronic
1066076294 10:31881035-31881057 GAGATGGAGGAGGGGAAGGTGGG - Intronic
1067227925 10:44387301-44387323 AAGATGGAGCAGAGGAAAGTGGG + Intergenic
1067607716 10:47681146-47681168 CAGGTGGAGGTGGAGAAAAGTGG + Intergenic
1068662228 10:59634364-59634386 AAAATGACTGTGGGGAAAATGGG - Intergenic
1068840784 10:61611655-61611677 AAAAGGGACGGGGGGAAAATTGG + Intergenic
1069753402 10:70759335-70759357 AAGAGGGAGGTGGGAAGAGTGGG - Intronic
1069933814 10:71901252-71901274 CAGATGGAGGGAGGGAAGATGGG - Intergenic
1070099914 10:73375164-73375186 AGGTGAGAGGTGGGGAAAATGGG + Intronic
1070583351 10:77741573-77741595 TAGATGGATTTGGAGAAAATTGG - Intergenic
1071513284 10:86280831-86280853 AAGAAGGAGGAAGGGAAAATGGG - Intronic
1071623274 10:87142543-87142565 CAGGTGGAGGTGGAGAAAAGTGG + Intronic
1071880398 10:89890678-89890700 GAGATGGGGGTGAGGAAAAAGGG + Intergenic
1072746217 10:97941036-97941058 TGGATGGGGGTGGGGCAAATAGG - Intronic
1072976219 10:100061090-100061112 ATGGTGGGGGTGGGGAGAATGGG + Intronic
1073017649 10:100414468-100414490 AAGATGGAAGGAGGGAAGATAGG + Intergenic
1073650617 10:105354430-105354452 AAGATGGAGGTCAGGCACATGGG - Intergenic
1073724420 10:106213231-106213253 TACTTGGAGGTGGGGAAAAAAGG - Intergenic
1073998771 10:109346090-109346112 AAGATGGAGGGAGAGAAAAATGG + Intergenic
1074486962 10:113894040-113894062 AAGGTGGAGGTGGTGAGAAGTGG + Intronic
1074674125 10:115828763-115828785 TAGATCGAGGTGGTGAAACTTGG - Intronic
1074732103 10:116390096-116390118 AAGGTGGAGGAGGAGAAGATGGG - Intergenic
1075561793 10:123473672-123473694 GAGATGAAGGTGGGGAAGAGAGG - Intergenic
1075871705 10:125775802-125775824 AAGATGGAGGCGGCGAGCATTGG + Exonic
1076243883 10:128931488-128931510 ATGTTGGGGGAGGGGAAAATGGG - Intergenic
1076566975 10:131405431-131405453 AAGAAGGAAGTGGGGAGAACAGG + Intergenic
1077087058 11:758528-758550 AAGATGGAGGGAAGGAAATTTGG + Intronic
1077098853 11:812269-812291 AGGGTGGAGGTGGGGAAATTGGG + Intronic
1077317024 11:1924160-1924182 GAGATGGAGGTGGAGAAATGGGG - Intronic
1077482492 11:2822407-2822429 GAGGTGGAGGTGGGGAAATGGGG + Intronic
1077937080 11:6799747-6799769 CAGAAGGAGGAGGGAAAAATGGG - Intergenic
1078230796 11:9440533-9440555 AAGATGGAGATGATGAAGATTGG + Exonic
1078618181 11:12884121-12884143 AAGATGGGGGTGGGGGAGGTAGG - Intronic
1078793225 11:14566103-14566125 AAGATGGAGTTGGAGGTAATGGG + Intronic
1078870285 11:15337048-15337070 AAGCTGAGGGTGGGGAGAATGGG - Intergenic
1078870328 11:15337751-15337773 AAGCTGAGGGTGGGGAGAATGGG - Intergenic
1078953813 11:16166777-16166799 AAGATAAATGTGAGGAAAATGGG + Intronic
1078987782 11:16611872-16611894 ACAAAGGAGGTGGGGAAAAGTGG + Intronic
1079910887 11:26307895-26307917 GAGATGAAGGAGAGGAAAATGGG - Intergenic
1079981722 11:27157997-27158019 AAGATGTAGGTTGGGAAGCTAGG + Intergenic
1080244461 11:30163947-30163969 AAGATGGGGATGGAGAAAAATGG + Intergenic
1080244527 11:30164423-30164445 AAGATGGGGATGGAGAAAAATGG + Intergenic
1080833725 11:35920384-35920406 AAAATGGACCTGGGCAAAATGGG - Intergenic
1080988046 11:37494545-37494567 GAGATGGGGGAAGGGAAAATGGG + Intergenic
1081365429 11:42229520-42229542 GAGATGGAGTTGGGGGAAAGTGG + Intergenic
1081569095 11:44278584-44278606 CAGCTGGAGGTGGGCAAAACTGG - Intronic
1082763512 11:57148604-57148626 AAAATGGAGGAGGGAAAAGTGGG + Intergenic
1084064668 11:66696927-66696949 AAGCTGGAAGTGGGGAAACCAGG - Intronic
1085957411 11:81416314-81416336 GAGCTGGAGATAGGGAAAATGGG - Intergenic
1086473582 11:87145105-87145127 AGGCTGGAGGTGGGGAAATGAGG - Intronic
1086565091 11:88216684-88216706 ATGAGGGAGGTCAGGAAAATAGG - Intergenic
1087238388 11:95747598-95747620 AGGATGGAGGTGAGGAAAAGTGG - Intergenic
1087259601 11:95995784-95995806 ATGATAGAAGTGAGGAAAATGGG - Intronic
1087273026 11:96131095-96131117 AAGATGTATGTTGGGAGAATGGG + Intronic
1087423240 11:97959239-97959261 AGGATGGAGGAAGGGAAAAAGGG + Intergenic
1087675216 11:101153807-101153829 AAGGTGAAGGAGGGGACAATGGG - Intergenic
1087687859 11:101285761-101285783 AAGCTGGAGGTGGGTCAAATTGG - Intergenic
1089619636 11:119714778-119714800 TAGAGGGAGGTGGGGAAGCTTGG + Intronic
1089642520 11:119857105-119857127 AGGAGGGAGGTGGGAAAGATTGG + Intergenic
1090421471 11:126578339-126578361 AAGAAAGAGGAGGGCAAAATGGG + Intronic
1091198178 11:133749509-133749531 GAGAAGAAGGTTGGGAAAATAGG + Intergenic
1091224271 11:133948404-133948426 AGGTTGGGGGTGGGGGAAATTGG - Intronic
1091440833 12:510947-510969 GTGCTGGAGGTGGGGAGAATTGG - Intronic
1092252109 12:6905277-6905299 AAGGGGGAGGTGGGAAGAATGGG + Intronic
1092600857 12:10062522-10062544 AACATGCAGGTGAGGAAAATTGG - Intronic
1092747731 12:11689330-11689352 CAGATGGAGGTGGGGAGGAGTGG + Intronic
1093062389 12:14620706-14620728 AAGTTGGGGGTGGGGAGAAAGGG + Intronic
1094182881 12:27610926-27610948 AGGGGTGAGGTGGGGAAAATAGG + Intronic
1094381373 12:29847203-29847225 GGAAAGGAGGTGGGGAAAATGGG - Intergenic
1094717214 12:33024533-33024555 ATGTTGGAGGTGGGGCATATTGG + Intergenic
1095154025 12:38830988-38831010 GTGTTGGAGGTGGGGAAAGTGGG + Intronic
1095408999 12:41901653-41901675 AGGCTGGAGGTGGGGAGAATGGG + Intergenic
1095766175 12:45898484-45898506 AGGAAGGATTTGGGGAAAATTGG + Intronic
1095847116 12:46758354-46758376 CAGATGGAGGTGAGGAATTTGGG + Intergenic
1096202664 12:49696641-49696663 AAGATCCAGGTGGAGATAATAGG - Intronic
1096315513 12:50561383-50561405 AAGATGGAGGTAGTGAATAAAGG - Intronic
1097432223 12:59524472-59524494 TAGATGCAGGTGGTGGAAATAGG + Intergenic
1097750336 12:63345545-63345567 AAGATGGTGGTGGGGAATTGAGG - Intergenic
1101111383 12:101489895-101489917 AAGCTGGAGGAGGGGGAGATGGG + Intergenic
1101234678 12:102776469-102776491 AAGATGATGGAGGGGAAAAAGGG - Intergenic
1101449993 12:104767373-104767395 GAGATGGAGGAGGGGAAGTTGGG - Intergenic
1102089859 12:110176891-110176913 AAGATAGAGAAGGGGAAAATTGG + Intronic
1102180764 12:110910942-110910964 AAGATGGAGGTGGATAAATGGGG + Exonic
1102647826 12:114415041-114415063 AAGATGGAGTTCGGGAGCATGGG - Intergenic
1104323248 12:127772032-127772054 GAGAGAGAGGTGGGGAAAAAGGG + Intergenic
1104411199 12:128559549-128559571 AAGATGGTGGTGGTGTGAATGGG - Intronic
1104584884 12:130039969-130039991 AAGAAGGATGTGGAGAAAGTGGG + Intergenic
1104616377 12:130273361-130273383 AAGAAGGAGGAGGAGAAAAGAGG - Intergenic
1104674347 12:130702622-130702644 AAGATGAAGGAGAAGAAAATAGG + Intronic
1104744171 12:131200817-131200839 AAGAGGGAGGTGGGGAACAGAGG - Intergenic
1104790208 12:131476406-131476428 AAGAGGGAGGTGGGGAACAGAGG + Intergenic
1105742774 13:23345853-23345875 AACATGAACTTGGGGAAAATAGG + Intronic
1106534512 13:30627832-30627854 AAGCTGGGGGAGAGGAAAATGGG - Intronic
1107020172 13:35743154-35743176 AAGAGGGAGATGGGGAATATAGG + Intergenic
1107985320 13:45770923-45770945 AAGAGGGAAGTGGGGAACATAGG + Intergenic
1107987916 13:45791854-45791876 AAGGTGCAGGAGGGGAACATTGG - Intronic
1108054047 13:46468278-46468300 AAGATCCAGGGGGGGAAAAGGGG - Intergenic
1108994465 13:56710174-56710196 AACATGAATATGGGGAAAATAGG + Intergenic
1109452950 13:62542239-62542261 AAGATGAAGCTGGTTAAAATGGG - Intergenic
1109939757 13:69346138-69346160 AATTTGGAAGTAGGGAAAATTGG + Intergenic
1110013944 13:70375801-70375823 AAGATGAAGGCTGGGAAACTTGG + Intergenic
1110393527 13:75003465-75003487 AGGCTGGGGGTGGGGAGAATGGG - Intergenic
1110528719 13:76571545-76571567 AAGTAGGAGGTGGGGGAAAAGGG - Intergenic
1110655179 13:77989358-77989380 AAGATGGATGTGAGTAAAACCGG - Intergenic
1110995306 13:82100344-82100366 AAGCAGGAGATGGGGAAACTGGG - Intergenic
1111405006 13:87792510-87792532 AAGAAGGGTGTGGAGAAAATGGG + Intergenic
1111892066 13:94095738-94095760 TAGATGGAGGGGGAGAAATTGGG + Intronic
1112593208 13:100783410-100783432 AAGTTGGAGGTTTGGAACATGGG - Intergenic
1113356778 13:109588633-109588655 AAGGTGGAGGAGGGGAGAAGAGG - Intergenic
1114642080 14:24230592-24230614 AAGAGAGAGGGGGAGAAAATAGG - Intronic
1115342260 14:32305071-32305093 AAGCTGGATGTGAGGAAAGTAGG + Intergenic
1115434608 14:33358592-33358614 AGGATGGAGGTGGGGAGAGGTGG - Intronic
1115466654 14:33722306-33722328 CTGATGGTGATGGGGAAAATGGG - Intronic
1115815576 14:37160973-37160995 AGGAAGGGGGTGGGGAAAAGGGG + Intronic
1116063076 14:39948527-39948549 AAGAATGAGGTGGGGATGATGGG - Intergenic
1116308850 14:43295142-43295164 AAGATTGATGTTGTGAAAATTGG - Intergenic
1116756119 14:48950073-48950095 GAGGTGGAGGTGAGGAAAATTGG - Intergenic
1117110041 14:52443226-52443248 AAGATGTAGGTTGGGAGACTAGG - Intronic
1117392460 14:55275175-55275197 AAGATGGAGGTGGGAATGAAAGG - Intronic
1117626060 14:57639393-57639415 AACATAGGGGTGGGGAAAATGGG - Intronic
1118346544 14:64945341-64945363 TTGATGGAGGTGGAGAATATTGG - Intronic
1118476380 14:66121216-66121238 AAGATGAAGGTGGGGAAGATTGG + Intergenic
1119387643 14:74267734-74267756 AGGAGGGAGGTGGGGACAACAGG - Intergenic
1119692247 14:76683870-76683892 AGGAAAGAGGTGGGGGAAATGGG - Intergenic
1119877053 14:78069846-78069868 AAGATGGAGGTAGGGAGATTGGG + Intergenic
1121474600 14:94185778-94185800 AAAATGGAGATGGGGGAATTTGG - Intronic
1121528735 14:94637980-94638002 AAGAAGGAGCTGCGGAAAGTGGG - Intergenic
1121528771 14:94638163-94638185 AAGAAGGAGCTGTGGAAAGTGGG - Intergenic
1122275762 14:100589969-100589991 TGGATGGAGGTGGGGGAGATAGG + Intergenic
1122473049 14:101985092-101985114 AAGATGGAGGAAGGGATAAATGG - Intronic
1123392343 15:19889253-19889275 AAGATTGAGGTTTTGAAAATGGG - Intergenic
1125013866 15:34910937-34910959 AGGTTGTAGGTGGGGAAAATGGG - Intronic
1125421771 15:39511407-39511429 AGGATGAAGTTGGGGAAAGTGGG - Intergenic
1126180445 15:45780327-45780349 AACATGGGGGTGGGGAATAGAGG - Intergenic
1126376458 15:48001731-48001753 AAGAAGGAGGTGGGTAGAAAGGG + Intergenic
1126750467 15:51871711-51871733 AGGATAGAGGTGAGGAATATGGG + Intronic
1127101568 15:55571018-55571040 GGGATGGAGAAGGGGAAAATGGG - Intronic
1127834553 15:62780250-62780272 AGGATGGTGGTGGTGAAGATGGG + Intronic
1127929701 15:63584972-63584994 AAGATGGTGCTGGGGAAACTAGG - Intronic
1128392322 15:67190582-67190604 ATGCAGGAGGTGGAGAAAATTGG + Exonic
1128712782 15:69884699-69884721 AAAAAGGAGATGGGAAAAATAGG + Intergenic
1129204861 15:74031136-74031158 GAGATGGGGGAGGGGGAAATGGG - Intronic
1129365103 15:75049296-75049318 AAGATGGATGTTGGCAAAATAGG + Exonic
1129798921 15:78398749-78398771 ATCAGGGAGGTGGGGAAAAAGGG - Intergenic
1130461852 15:84164897-84164919 AGGACGGAGGTGGGGAAGAGAGG + Intergenic
1131055020 15:89370009-89370031 AAAATGGAGGTGGGGTACAAAGG - Intergenic
1131109782 15:89758151-89758173 AAGAGAGAGGTGGGGCAGATGGG + Intergenic
1131758157 15:95588722-95588744 TAGATAGGGGTGGGGAGAATGGG + Intergenic
1132097166 15:98995812-98995834 AGGAAGGTGGTGGGGGAAATGGG - Intronic
1132396449 15:101478504-101478526 AAGAGGGAGGGAGGGAAAGTGGG - Intronic
1132878512 16:2150707-2150729 AAGAGGGAGGTGGGGAAGTGGGG - Intronic
1133264704 16:4576069-4576091 AAGATAGAGGTGGCAAAGATGGG + Exonic
1134156049 16:11844186-11844208 AAGATGGTGGGGGGGAAGAAGGG + Intronic
1135571568 16:23553277-23553299 TGGATGCAGTTGGGGAAAATTGG - Intronic
1135869633 16:26137314-26137336 GAGGTGGTGGTGGGGCAAATTGG - Exonic
1136043637 16:27599387-27599409 GAGATGGGGGTGGGGAAGGTGGG + Intronic
1136716481 16:32287191-32287213 GAGATGGAGAAGGGGGAAATGGG - Intergenic
1136834867 16:33493469-33493491 GAGATGGAGAAGGGGGAAATGGG - Intergenic
1137444192 16:48522029-48522051 AAGCTGTTGGTGGGGAAATTGGG - Intergenic
1137616684 16:49852642-49852664 AAGGTGTAGGGAGGGAAAATCGG + Intronic
1137677692 16:50311825-50311847 CAGATGGAGGTGAGGAAAAGTGG - Intronic
1137961735 16:52887982-52888004 AAGAAGGATTTGGGGATAATTGG - Intergenic
1138142433 16:54580445-54580467 AAGACTGAGGTGGGGAGAGTGGG - Intergenic
1139113769 16:63924209-63924231 AGCTGGGAGGTGGGGAAAATGGG + Intergenic
1139328441 16:66169416-66169438 AAGAGAGAGGTGGGGAAAGAAGG + Intergenic
1139846079 16:69922546-69922568 AGGATGGAGATGGGGGAAAGCGG - Intronic
1140986566 16:80163513-80163535 AAGAAGAAGGTGGGGTACATGGG - Intergenic
1203009936 16_KI270728v1_random:230563-230585 GAGATGGAGAAGGGGGAAATGGG + Intergenic
1203145033 16_KI270728v1_random:1793757-1793779 GAGATGGAGAAGGGGGAAATGGG - Intergenic
1142710060 17:1718091-1718113 AATAAGGAGGTGGAGTAAATGGG - Intronic
1142878347 17:2866037-2866059 AAGAGGGAGGTGTGGAGAAGAGG + Intronic
1143021319 17:3918311-3918333 AAGAAGGAGGGAGGGAAAAAAGG + Intergenic
1143474007 17:7192714-7192736 CAGATGGTGGTGGGGAATTTGGG + Intronic
1144088390 17:11831484-11831506 ATGTTGGAGGTGGGGACAAGTGG - Intronic
1144136555 17:12300924-12300946 AAGATGTAGGCTGGGAAACTAGG - Intergenic
1144168455 17:12635112-12635134 AGGATGGAGCTCGGGAAACTCGG - Intergenic
1146125818 17:30230615-30230637 AAGAGGGAAGTGGGGAAAAGGGG + Intronic
1146199689 17:30846126-30846148 ATGGTGGTGGTGGGGATAATAGG - Intronic
1146415835 17:32631864-32631886 AATATAGGGGTGGGGAACATGGG + Intronic
1146688465 17:34857062-34857084 AAGATGGAGGTAGGGAAGGATGG + Intergenic
1146813406 17:35922846-35922868 TAGATGGAGGTAGTAAAAATGGG - Intronic
1146841431 17:36158510-36158532 GGGCTGGAGGTGGGGAAAATGGG - Intergenic
1146853684 17:36246151-36246173 GGGCTGGAGGTGGGGAAAATGGG - Intronic
1146869592 17:36370043-36370065 GGGCTGGAGGTGGGGAAAATGGG - Intronic
1147072468 17:37970667-37970689 GGGCTGGAGGTGGGGAAAATGGG - Intergenic
1147083992 17:38050204-38050226 GGGCTGGAGGTGGGGAAAATGGG - Intronic
1147099939 17:38174171-38174193 GGGCTGGAGGTGGGGAAAATGGG - Intergenic
1147357059 17:39906446-39906468 AAGATGGAAGTGGGGTCAGTGGG - Intronic
1147406948 17:40219286-40219308 AAAATGGAGGCGGGGGAAAAAGG - Intronic
1148083631 17:44980949-44980971 AAGCTGGACTTGGGGAGAATGGG + Intergenic
1148679475 17:49465506-49465528 GAGGTGGGGGTGAGGAAAATGGG + Intronic
1148876431 17:50690088-50690110 AGGATGGAGGTGGGGCAATAAGG + Intronic
1149433168 17:56610781-56610803 AAGAGTGAGCTGGGCAAAATGGG + Intergenic
1149455631 17:56785872-56785894 GAGATGGAGGTGGGGATACAAGG - Intergenic
1149782714 17:59410617-59410639 GAGATGGAGGTGGGAAAATATGG + Intergenic
1149784260 17:59422207-59422229 AAGATGGAGGTTCAGAAAAGTGG + Intergenic
1149857876 17:60098867-60098889 GGGCTGGGGGTGGGGAAAATGGG + Intergenic
1150605098 17:66683986-66684008 AAGATGGAAGAGGGGAAGCTGGG - Intronic
1150855022 17:68744285-68744307 GGGGTGGAGGTGGGGAAAATGGG + Intergenic
1151214649 17:72569312-72569334 AAAAATGAGGTGGGGAAAAAAGG + Intergenic
1151320925 17:73352001-73352023 AAGAATGAGGGGAGGAAAATGGG + Intronic
1152050866 17:77975469-77975491 AAGATGGTGGTGGAGGGAATGGG + Intergenic
1153022338 18:641261-641283 AACTTGGAGGTGGGCAACATGGG - Intronic
1153159049 18:2181839-2181861 AGGATGGCGGTGGGGTATATGGG + Intergenic
1153169639 18:2301175-2301197 AAGATGGAGGAAGGGGAAAGGGG + Intergenic
1153866350 18:9272956-9272978 AACGTGGGGGTGGGGAGAATGGG + Intronic
1153972810 18:10241805-10241827 ACGATGGAGCTGTGGAAAAGAGG + Intergenic
1155082983 18:22429171-22429193 AAGATGGAGCTGAGGAAATTCGG + Intergenic
1155487386 18:26360409-26360431 AAAATGGGGCTAGGGAAAATGGG - Intronic
1155535550 18:26812746-26812768 AAGAGGGAGGTGGGGAGTAGGGG + Intergenic
1155970113 18:32075158-32075180 AAAATGGAGGTGGTGAGAAATGG - Intergenic
1156028784 18:32688904-32688926 AAGGTGGAGGTGGTGAGAAATGG + Intronic
1156693650 18:39739490-39739512 GGGCTGGGGGTGGGGAAAATGGG + Intergenic
1157163119 18:45332986-45333008 AAAATGCAGCTGGGGTAAATGGG + Intronic
1157600995 18:48893228-48893250 AAGATGGGGGTGGGGGACAGAGG + Intergenic
1157897592 18:51483671-51483693 AGGATGGAGGTAGGGAATATGGG - Intergenic
1158123507 18:54076947-54076969 ATAATGGAGGTGAGGAAAAGGGG + Intergenic
1158684166 18:59598040-59598062 AAAATGGAGGTTAGGAACATTGG + Intronic
1159092599 18:63866440-63866462 ATGATGATGATGGGGAAAATAGG + Intergenic
1159623332 18:70665229-70665251 AAGGAGGAGTAGGGGAAAATGGG - Intergenic
1159734831 18:72082625-72082647 AAGAAAGAGGAGGGCAAAATAGG + Intergenic
1161012282 19:1966170-1966192 CTGATGGAGCTGGGGAAATTGGG + Intronic
1161414752 19:4139725-4139747 GAGAAGGAGGAGGGGAAGATGGG + Intergenic
1161451760 19:4350264-4350286 GAGAAGGAGGTGGGGAGGATGGG + Intronic
1162469564 19:10864390-10864412 AAGCAGGAGGTGGGGAAGATTGG + Intronic
1162565204 19:11442132-11442154 AAGATAGGGATGGGGCAAATGGG + Intronic
1163198472 19:15743424-15743446 AAAAAGGAGGTTGGTAAAATAGG + Intergenic
1163423906 19:17230363-17230385 AAGATGGACATGGGGAGACTAGG + Intergenic
1164771632 19:30813995-30814017 AATGTTGAGATGGGGAAAATTGG + Intergenic
1166552528 19:43675786-43675808 GAGATGGAGGTGGGGAAACGAGG + Intergenic
1166944694 19:46389844-46389866 AGGATGGGGATGGGGAAAAGAGG - Intronic
1167019411 19:46862312-46862334 AAAAAGGAGGTGGGGAAGAGAGG - Intergenic
1167195013 19:48022539-48022561 AAGGTGGAGTTGGGGAAGACTGG + Intronic
1167640762 19:50680120-50680142 GAGAGGGAGGTGGGGAAACAGGG + Intronic
924959924 2:25473-25495 AGGTTGGAGGAGGGAAAAATGGG - Intergenic
925140386 2:1546220-1546242 AAGATGCAGGTCAGGAAAAATGG - Intergenic
925622436 2:5807208-5807230 AAGATGGGGGTGGGGGAGGTGGG - Intergenic
925772872 2:7300588-7300610 AAGATAGATGTGGTGAAATTGGG - Intergenic
926227616 2:10979354-10979376 AAGATGGAGGTGGGGGTGACAGG + Intergenic
927128561 2:20036571-20036593 AATTTGGTGGTGTGGAAAATGGG + Intronic
927304018 2:21549561-21549583 AACATGGAGAGGGAGAAAATGGG + Intergenic
927919897 2:26964146-26964168 AAGATAGAGGTTAGGAACATTGG - Intergenic
927930385 2:27040001-27040023 AAGATGGAAGTGGGGGAAGAGGG - Intronic
928416430 2:31096055-31096077 AAGATGGAGATGAAGAAAAGAGG - Intronic
929408410 2:41669187-41669209 AATATGGAGGTAGGGAAAGGAGG - Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
932763515 2:74455942-74455964 GATCTGGAGGTGGGGAAACTGGG + Intronic
933121983 2:78549970-78549992 AAGATGTACGATGGGAAAATTGG - Intergenic
934674355 2:96239208-96239230 AAGAGGGAGATGGGGAGTATCGG + Intergenic
934707056 2:96489457-96489479 GAGATGGTGGTGGGGAAAATGGG - Intergenic
935126098 2:100224208-100224230 ATGCTGGAGGTGGTGAAAAATGG - Intergenic
935191583 2:100782520-100782542 GAGATGGGGGTGGGGACAGTGGG + Intergenic
935318715 2:101863900-101863922 AAGATGGTGGTGTGCAAATTTGG - Intronic
935954406 2:108361472-108361494 AAGTTGGAGTGGGGGAAGATGGG - Intergenic
936745712 2:115574134-115574156 AGGGTGGAGATGGGGAAAACGGG - Intronic
936921593 2:117694716-117694738 AAGATGGAGGTGAGGACAACAGG - Intergenic
936965355 2:118122636-118122658 AAGTTGGAGATGAGGAAAAGGGG + Intergenic
937006562 2:118521699-118521721 GAGAGGGAGGTGAGGAAAGTAGG + Intergenic
937348019 2:121139613-121139635 TATAGGGAGGTGTGGAAAATTGG - Intergenic
938572380 2:132572287-132572309 AAGAAAGAGGTGCTGAAAATAGG - Intronic
940347572 2:152643297-152643319 GGGATGGGGGTGGGGAAGATGGG - Intronic
940489611 2:154341617-154341639 AAGAAGGAGGAGAGGAAAAGAGG + Intronic
940692375 2:156935074-156935096 AAGTTGGAGTTGAAGAAAATTGG - Intergenic
941838462 2:170052677-170052699 GACAGGGAGGTGGGGAAAATGGG + Intronic
941859299 2:170262462-170262484 AAGGATGAGTTGGGGAAAATAGG + Intronic
942034413 2:171996866-171996888 AAGAAGGAGGAAGGAAAAATGGG + Intronic
942762178 2:179412085-179412107 AAGATGTAGATGGGGGAAAAGGG + Intergenic
943437272 2:187881607-187881629 AAGAGGGAAGTGGGGAATGTAGG - Intergenic
943762681 2:191627009-191627031 CAGATGGAAGTAGGGAAAAGAGG - Intergenic
944103087 2:196050332-196050354 GAGGTGGGGGAGGGGAAAATGGG + Intronic
944225218 2:197342870-197342892 AAGATGAGGGTGGCGAAACTGGG + Intergenic
945705645 2:213227850-213227872 ATGATGAAGTTGGGGAAAAATGG - Intergenic
946313561 2:218895973-218895995 GTGATGGAGGGTGGGAAAATGGG + Intronic
946337475 2:219048194-219048216 CAGATGGAGGTGGTGACAAAGGG - Intergenic
946631365 2:221672600-221672622 AAGATGCAGCTATGGAAAATGGG - Intergenic
947747216 2:232514550-232514572 ATGTAGGAGGAGGGGAAAATGGG + Intergenic
947952374 2:234159434-234159456 AGGGTGGTGGTGGTGAAAATGGG + Intergenic
947956604 2:234197451-234197473 ATGTTGGAGGTGGGGACTATTGG - Intergenic
948255184 2:236563203-236563225 ATGAAGCAGGTGGGCAAAATAGG + Intergenic
948480643 2:238248071-238248093 AGGGTGCAGGTGGGGAAAAGAGG + Intronic
1168837342 20:886017-886039 AAGATGGAGAGGAGGAAGATGGG + Intronic
1169207236 20:3747435-3747457 GAGAAGGAGGGTGGGAAAATAGG - Intronic
1170046980 20:12095903-12095925 AAGATGGGGGTGGGGAGATGTGG + Intergenic
1171845832 20:30273999-30274021 AACATGGAAGTCAGGAAAATAGG - Intergenic
1172537952 20:35688755-35688777 AAGAGGGAGGGAGGGAAAAGAGG + Intronic
1172783523 20:37451232-37451254 AGGAAGGAGGTGGGGAGAAGGGG - Intergenic
1174064105 20:47852273-47852295 ATGGTGGAGGTGGGGAGAAGCGG + Intergenic
1174718585 20:52786465-52786487 AAGATGAAGCTGGGGAAAGATGG + Intergenic
1177649702 21:23944901-23944923 AAGAGGGAGGTGGGGAAAGAGGG - Intergenic
1178175244 21:30089707-30089729 AAGATGGAGGTGGGGAGGGAGGG - Intergenic
1178451762 21:32708147-32708169 AAGGTGGGGGTGGGAAATATAGG + Intronic
1179006743 21:37521948-37521970 TGGATGGAGGAGGGGAAAGTCGG + Intergenic
1179100259 21:38350394-38350416 AAGCTGGAAATGAGGAAAATGGG + Intergenic
1179632048 21:42684642-42684664 AAGGAGGATGTGGGGGAAATGGG + Intronic
1180154418 21:45971162-45971184 GAGATGGCGGTGGGGGAAACGGG - Intergenic
1180320036 22:11311335-11311357 AAGATGGAGGGAGAGAAAGTTGG - Intergenic
1180904677 22:19401051-19401073 AAGATGGAGGAGAAGAAAAGGGG - Intronic
1181552503 22:23648768-23648790 AAAATGGAAGTGGAGAAAACTGG - Intergenic
1182061446 22:27401151-27401173 AATCTGGGGGTGGGGAAAACAGG - Intergenic
1182760866 22:32721353-32721375 AAGATGGAGGCAGGGAAAGGGGG - Intronic
1182857379 22:33529717-33529739 AAGATGCAGGATGGTAAAATAGG + Intronic
1182945748 22:34319826-34319848 GAGATGGAGGTGGGGTAGGTTGG + Intergenic
1183491549 22:38119345-38119367 CAGATGGGGCTGGGAAAAATTGG + Intronic
1183754347 22:39746192-39746214 AAGATGGAGGCGGGGAAAATGGG - Intronic
1184238735 22:43200447-43200469 AAGATGGAGGTGTAGAGAAAAGG - Exonic
1184402199 22:44280686-44280708 GGGAGGGAGGTGGGGACAATGGG + Intronic
1184449968 22:44576962-44576984 CTCATAGAGGTGGGGAAAATGGG + Intergenic
1184940917 22:47764259-47764281 ATTATGGGGGAGGGGAAAATGGG - Intergenic
949502325 3:4692831-4692853 AAGATGGAGGCAGGGCACATTGG + Intronic
952477209 3:33722646-33722668 AGAAAGGAGGTGGAGAAAATGGG + Intergenic
952962003 3:38598186-38598208 AAGATGGAGGTGGGGAAAATGGG + Intronic
953193908 3:40714134-40714156 AATGTGGAAGTGGGGGAAATTGG - Intergenic
953338540 3:42114574-42114596 CAGATGGAGCTGGTGTAAATTGG - Intronic
953523993 3:43671804-43671826 ATGCTGCAGGTGGGGGAAATGGG - Intronic
953554186 3:43929861-43929883 AGGATGGAGGAGGAGCAAATGGG + Intergenic
954418320 3:50405176-50405198 AAGAGGGAGGTGGGGACAAAAGG + Intronic
954677281 3:52322923-52322945 AGGATGGATGAGGGGATAATAGG - Intronic
954827369 3:53385878-53385900 AAGATGGTGGTGGTGACAAGGGG - Intergenic
955412704 3:58666493-58666515 AAAATGGAGGTGGGGAGGGTGGG - Intronic
955456698 3:59129412-59129434 AAGAAGGAGTTGGGGATACTTGG - Intergenic
956004257 3:64762057-64762079 GAGGTGGAGGAGGGGAAAATGGG - Intergenic
956518499 3:70078107-70078129 AAGATGGGGGTGGGGAGGAGTGG + Intergenic
956662002 3:71608344-71608366 AAGATCGATGTGGAGAAAATTGG - Intergenic
957550681 3:81699641-81699663 AAGATGTAGGCTGGGAAACTAGG + Intronic
958558434 3:95709750-95709772 AAGAGGGAAATGGGGAAAAAGGG + Intergenic
959481617 3:106879525-106879547 AACTGGGAGGTGGGGGAAATGGG + Intergenic
959643566 3:108670293-108670315 AAGCTAGAGGAGGGGAGAATAGG - Intronic
959855525 3:111151869-111151891 TAGATGGGGGTAGGGTAAATAGG - Intronic
960051378 3:113241974-113241996 AAGGTGGAGGTGGGGTAGAAAGG + Intronic
960812315 3:121636686-121636708 AAGATGGAAGTAGGGAAACATGG + Intronic
960837852 3:121926014-121926036 AAGATGGAGGTGGGTAAATGTGG + Intronic
960952670 3:123009774-123009796 AAGATATAGGAGGGGAAAACTGG + Intronic
960966220 3:123106682-123106704 AAGAGGGAGGTGGGGGAATCAGG - Intronic
964244384 3:154633810-154633832 AAGAGGGAAGTGGAGAAAAATGG - Intergenic
964878851 3:161400971-161400993 AAAAAGGAGGTGGGGAAATATGG - Intergenic
965064725 3:163831496-163831518 AAGATAGAGGGAGGGAAAAAAGG - Intergenic
965110504 3:164415235-164415257 AAGATGTAGGTTGGGAAGTTAGG - Intergenic
965291441 3:166887001-166887023 AAGATGGAGGCTGGGAGACTAGG + Intergenic
965512377 3:169582411-169582433 AAGAGGGAGATGGGGAAAAACGG + Intronic
965642756 3:170848010-170848032 AAGATGAACCTGGGAAAAATAGG + Intronic
965853769 3:173063745-173063767 TAAATGTAAGTGGGGAAAATTGG + Intronic
965874567 3:173300546-173300568 AAAGTGGAGGCGGGGTAAATTGG + Intergenic
965987141 3:174768080-174768102 TTGGTGGAGGTGGGGAAAAGAGG + Intronic
966120350 3:176513207-176513229 AAGAATGAAGTGGGGAAAGTGGG + Intergenic
966531886 3:180989976-180989998 AAGATGTAGGGGGAAAAAATCGG - Intergenic
966627758 3:182036959-182036981 AAGATTTGGGTGGGGAAAACTGG + Intergenic
966745235 3:183268490-183268512 ATAATGGAAGTGGAGAAAATGGG + Intronic
967046486 3:185742059-185742081 AAGCTGAAGGTGGAGAATATTGG + Intronic
967290671 3:187916784-187916806 ATGCAGGAGGTGGGGACAATTGG - Intergenic
967410563 3:189162752-189162774 AAGATACACGTGGGGAAATTTGG + Intronic
968148046 3:196316022-196316044 AAGATGGAGAGGGGGCAAATGGG + Intronic
969341827 4:6546897-6546919 AAGATGGAAGAGGGGAGAAAAGG + Intronic
969923897 4:10567230-10567252 AAGATAGATGTGCGGATAATTGG + Intronic
970052757 4:11933762-11933784 TAGGTGGAGGAGGGGAAAACTGG + Intergenic
970345400 4:15147986-15148008 ATCATGGAGCTGGTGAAAATGGG - Intergenic
971322127 4:25614147-25614169 AAGGTGCAGGTTGGGAAGATGGG + Intergenic
971708006 4:30073151-30073173 AAGATGGAGGAGGGGCAATGAGG + Intergenic
972031257 4:34461331-34461353 AAGAATATGGTGGGGAAAATAGG + Intergenic
972341702 4:38157639-38157661 ATGTTGGAGGTGGGCCAAATGGG - Intergenic
973133490 4:46677050-46677072 AGGATGCAGGTAGAGAAAATGGG - Intergenic
973724521 4:53761927-53761949 AGGCTGGGGGTTGGGAAAATGGG + Intronic
973975605 4:56259484-56259506 AAGTAGGAGGTGGGGAACAGGGG + Intronic
974216935 4:58859959-58859981 AAGATGATGGTGATGAAAATTGG - Intergenic
974379447 4:61119629-61119651 CATATGGAAGTGGGGAATATAGG - Intergenic
974482066 4:62457664-62457686 GGGATGGAGGTGGGGAGAACTGG + Intergenic
975123832 4:70759144-70759166 AGTATGGAGGAGGGGAAGATAGG - Intronic
975948304 4:79736435-79736457 AAGAGTGGGGTGGGGGAAATGGG - Intergenic
977513053 4:97985991-97986013 GAGATGGATGTGGGGAAGACAGG - Intronic
978157315 4:105504911-105504933 AGGATGGAGGAGGGCAAAATGGG - Intergenic
978356306 4:107878320-107878342 GAAATGGAGCTGGGGAAAAGGGG + Intronic
979197678 4:117940339-117940361 CAGAAGGAGATGGGGAGAATGGG - Intergenic
979404103 4:120287690-120287712 AAGAATGAGGTAGGGATAATTGG + Intergenic
979676216 4:123413035-123413057 AAGATGCCTGTGGGGAAAAGAGG + Intergenic
980431287 4:132700219-132700241 GAGATGGAGGTGGGGAAAACTGG + Intergenic
980681625 4:136169794-136169816 GAGATGAAGGTGGGGAACAGTGG + Intergenic
980690537 4:136290767-136290789 ATGATGGAGGTGGTGAGAAGTGG + Intergenic
981360511 4:143840246-143840268 ATGATCCAGGTGGGGAAGATGGG + Intergenic
982245243 4:153344602-153344624 ACGGTGGAGGTGGGGGAAAGAGG - Intergenic
982575322 4:157102338-157102360 AGGCTGGGGGTAGGGAAAATGGG - Intronic
982905849 4:161069456-161069478 AATATGGAACTGGGGAAAATTGG - Intergenic
984583000 4:181532236-181532258 TAAATGGAGGAGGGCAAAATTGG + Intergenic
984658201 4:182342955-182342977 AAGAAGGAGATTGGGAAAATGGG - Intronic
984950342 4:185003318-185003340 ATGATGGAGGTGGAAATAATGGG - Intergenic
984954250 4:185030075-185030097 AAAATGGAGGCTGGGAGAATTGG - Intergenic
985960610 5:3300683-3300705 AAGATCCAGAGGGGGAAAATGGG + Intergenic
986018909 5:3782678-3782700 TTCATGGAGGTGAGGAAAATGGG - Intergenic
987236805 5:15950759-15950781 AAGATGGAAGTGGTGAGAAGTGG + Intergenic
987483638 5:18493368-18493390 GAGATTGATGTTGGGAAAATTGG + Intergenic
987639795 5:20598346-20598368 AAGTTGGAGGTGGGCCTAATGGG + Intergenic
987668696 5:20980655-20980677 AAGATGTAGGCTGGGAGAATAGG + Intergenic
987897683 5:23969437-23969459 GAGATAGATGTGGGAAAAATTGG + Intronic
989568634 5:42925122-42925144 AAGGGGGAGGTGGGGACAAAGGG - Intergenic
989775410 5:45200758-45200780 AATATGGAAGTGGGAGAAATGGG - Intergenic
990232861 5:53733975-53733997 AACATGGAGATGGAGAAGATAGG - Intergenic
990277522 5:54214091-54214113 GAGATGGAAGGGGGGAAAAAAGG + Intronic
990667685 5:58092157-58092179 AAGATAGAGGAGGAGAATATGGG + Intergenic
990998100 5:61753551-61753573 AAAATGGAGGTGGGAGAGATGGG + Intergenic
991117675 5:62972791-62972813 AAGATGGATGTGGGCAAAGGAGG - Intergenic
991180646 5:63747145-63747167 AAGATGGGGGAGGGAAAAAGTGG - Intergenic
991988128 5:72310401-72310423 AAGAGGGGGGTGGGGGAAAATGG + Intronic
991993542 5:72365058-72365080 AAGATGGGGATGGGGAAAGAAGG + Intergenic
992083718 5:73259365-73259387 AGGGTGGAGGTGGGGAAGACTGG + Intergenic
992244699 5:74808469-74808491 AAGATGGGGGTAGGGGAAAAGGG + Intronic
993396226 5:87392613-87392635 AAGATTGAGGTGTGATAAATGGG - Intronic
993458273 5:88150410-88150432 GTAATGGAGGTGGAGAAAATTGG - Intergenic
993579812 5:89646490-89646512 ATAATTGAGGTGGTGAAAATGGG - Intergenic
994024305 5:95063928-95063950 AAGATGGAGATAAGGAGAATAGG - Intronic
994363407 5:98882399-98882421 ATGATTTAGCTGGGGAAAATGGG + Intronic
994723991 5:103413461-103413483 AAGGTGAAGGTGAGGAAAAAGGG + Intergenic
995346542 5:111126574-111126596 TTGATAGAGGAGGGGAAAATGGG + Intronic
995794241 5:115924931-115924953 AAGATGGAAGTGGTGTACATGGG + Intergenic
995932133 5:117458758-117458780 AGTATGGAGTTGGGGAAAAATGG - Intergenic
996994879 5:129683746-129683768 TAGTTGGAGGTGGGCAAAAGTGG - Intronic
997898259 5:137739683-137739705 AGGATGGAGGGAGGGAAAAGGGG + Intergenic
998012348 5:138705336-138705358 AAGAGGGAGGTGGGGGAACCAGG + Intronic
1000207189 5:159073666-159073688 AAGAAGGAGGTGGGGGAGAGGGG + Intronic
1000463427 5:161548217-161548239 AAGCTTGGGGTGGGGAAATTGGG + Intronic
1000464435 5:161558183-161558205 AAGATGGATGTGGTGAATTTGGG - Intronic
1000490839 5:161911397-161911419 AAGATGGGGGTGAGGAAAATGGG + Intergenic
1000895269 5:166847605-166847627 AAGATAGAGGAGGGGGAAAATGG + Intergenic
1001293953 5:170485728-170485750 AGGAAGGAGGAGGAGAAAATAGG + Intronic
1001451288 5:171826632-171826654 AACATGGAGGTGGTGTAACTAGG + Intergenic
1001746464 5:174096427-174096449 ATCATGGGGGTGGGGAAAACTGG + Intronic
1002317272 5:178351228-178351250 AAGATCTAGGTGGGGAGAAAGGG + Intronic
1003485370 6:6571514-6571536 AACTTGGGGGAGGGGAAAATGGG - Intergenic
1005048692 6:21665211-21665233 AGCAGGGAGGTGGGGGAAATGGG - Intergenic
1005631283 6:27710656-27710678 AAGAAGTAAGTGGGGAAAAAGGG - Intergenic
1005769704 6:29055234-29055256 AAGCTGGGGGAGGGGAAAATAGG - Intergenic
1006736623 6:36278083-36278105 GAGATGGAGTGGGGTAAAATGGG - Intronic
1007160937 6:39791489-39791511 CAGAGGGAGCTGGGGAAAATAGG + Intergenic
1007187123 6:39981375-39981397 AAGATGGGGGTGGGGAGTAAGGG + Intergenic
1007570058 6:42883259-42883281 AAGGTGGAGTTGAGGAAACTTGG - Intronic
1007913523 6:45539024-45539046 AAGATGGAGGGGGAGAGAAAAGG - Intronic
1008162333 6:48093693-48093715 TATATGAAGGTGGGGAAAAGGGG - Intergenic
1009594011 6:65711084-65711106 AAGAGGGAGGTGGGCAAGAGTGG - Intergenic
1009620681 6:66072041-66072063 AAGAAGGTGGTGGGGAAAGGAGG + Intergenic
1010151081 6:72732891-72732913 AATCAGGAAGTGGGGAAAATGGG + Intronic
1011045600 6:83078426-83078448 AAGGTGAAGGTAGTGAAAATAGG + Intronic
1011492997 6:87911799-87911821 AAGATGAAGGGGGAGAAATTGGG - Intergenic
1012003435 6:93683445-93683467 GTGATTGAGGTGGGGGAAATGGG - Intergenic
1013496683 6:110704827-110704849 GAGATGGAGGGAGGGAGAATAGG + Intronic
1014407389 6:121068545-121068567 CAGATGGAGGTGAGGAACTTGGG + Intergenic
1014550333 6:122782792-122782814 GAGATGGAGGTGGGGAGCAGAGG + Intronic
1014733917 6:125068954-125068976 AAGCTGAAGGAGGGGAAAACTGG + Intronic
1015357565 6:132297019-132297041 AAAAAGGAGGGAGGGAAAATGGG + Exonic
1015765408 6:136710896-136710918 AAGATGGAGCTGAGGAGTATAGG - Intronic
1015848415 6:137546963-137546985 AAGCTGGGGGAGGGGCAAATGGG - Intergenic
1016224024 6:141711481-141711503 GAGCTGGAGGAGGGGGAAATAGG + Intergenic
1016463392 6:144302000-144302022 AAGATGGAGGTTGCAAAACTGGG - Intronic
1016729452 6:147412864-147412886 GGGACTGAGGTGGGGAAAATGGG + Intergenic
1017548391 6:155476915-155476937 AAGACTGATTTGGGGAAAATTGG - Intergenic
1018202758 6:161410650-161410672 CAGATGGAGTTGGGGAAACATGG + Intronic
1019134933 6:169902112-169902134 ATGATGGAGGTGATGAAGATGGG + Intergenic
1019227837 6:170529741-170529763 ATGCTGGAGGTGTGCAAAATTGG - Intergenic
1020869955 7:13615722-13615744 AAGTTGAGGGTTGGGAAAATTGG + Intergenic
1020947951 7:14639100-14639122 TAGATGTATGTGGGGAGAATGGG + Intronic
1022636019 7:32136107-32136129 GAGGTAGAGGTGGGGAAAATGGG + Intronic
1022702029 7:32770686-32770708 AGGATGGGGGTGGGGAGAGTGGG - Intergenic
1023294134 7:38697655-38697677 CAGATGAATGTGGGAAAAATTGG + Intergenic
1023340636 7:39215678-39215700 TAGATGGAGGTGGGGAAGCGTGG + Intronic
1023588253 7:41753446-41753468 AAGAAGCAGGAGGGGAAAAAAGG + Intergenic
1023638280 7:42235639-42235661 AAGAGGGAGGAGAGGAAAAGGGG + Intronic
1023698286 7:42869796-42869818 CAGATGGAGTTGGGGAAGATGGG - Intergenic
1024147858 7:46535580-46535602 CAGATGGGGGTGGGGAAAAGGGG - Intergenic
1024435550 7:49349788-49349810 GAGCTGGAGGAGGAGAAAATGGG - Intergenic
1025104717 7:56161714-56161736 TGGATGTAGTTGGGGAAAATAGG + Intergenic
1026325896 7:69310222-69310244 AAGTTGGGGGAGGGGAATATGGG + Intergenic
1026394417 7:69936978-69937000 AAGATGGAGGGGAAGAAAAAAGG - Intronic
1027170216 7:75866561-75866583 ACGATGGACCTGGGGAAATTGGG + Intronic
1028290201 7:89056255-89056277 AATGTAGAGGTGGGCAAAATTGG + Intronic
1028441476 7:90867614-90867636 AATAAGGAGGAGGGGAAAATAGG + Intronic
1028525624 7:91782643-91782665 AAGATGGTGGTGGTGGAAATGGG - Intronic
1029027768 7:97435518-97435540 AAGATGGAGGTAAGGAAAAAAGG + Intergenic
1030744923 7:113153496-113153518 AAGAGGGATGTGGGGAAAGCAGG - Intergenic
1031085632 7:117299154-117299176 AAGATGGGGGTGGGGCACATGGG - Intronic
1032278601 7:130482645-130482667 AAGATCTAGGTGGGGCAAATTGG - Intergenic
1032341502 7:131078238-131078260 CAGATGGAGGAGAGGGAAATGGG + Intergenic
1032593424 7:133214789-133214811 AAGATGGATGTGATGAAAATTGG - Intergenic
1032710752 7:134458634-134458656 GAGAGGGAGGCGGGGAAAGTGGG - Intronic
1033075550 7:138247025-138247047 AAGGAGGAGATGGGGAATATAGG - Intergenic
1033501039 7:141950053-141950075 AAGCAGGAGGTGGGGAAGAGGGG - Intronic
1033669313 7:143475768-143475790 AAGGCTGAGGTGGGGAAGATTGG + Intergenic
1034237360 7:149582728-149582750 GAGAGGGCGGTGAGGAAAATAGG - Intergenic
1034237369 7:149582794-149582816 GAGAAGGTGGTGAGGAAAATAGG - Intergenic
1035334421 7:158116727-158116749 AAAATGAAGGTGGGAAAAATGGG - Intronic
1035836625 8:2761408-2761430 AGGATGGATGTGGGGCAAAATGG - Intergenic
1036150197 8:6289915-6289937 AGGGTGGTGGTGGGGAAATTAGG - Intergenic
1036476394 8:9097107-9097129 AGGATGGAGGGGGTGTAAATGGG - Intronic
1036592499 8:10181715-10181737 ATGATGGAGGTGGTGAGAAGTGG + Intronic
1036935385 8:12997175-12997197 ATGTTGGAGGTGGGGACTATTGG + Intronic
1036957083 8:13199724-13199746 AACATAGAGGTGAGGGAAATGGG + Intronic
1037742122 8:21616321-21616343 AGGAAGGTGGTGGGGACAATGGG + Intergenic
1037755256 8:21706161-21706183 AAGAGGGAGGGGAGGAAAGTCGG + Intronic
1038097477 8:24330974-24330996 AAGTTGGAGGTGGGTTAATTCGG + Intronic
1038477925 8:27881519-27881541 AAGATGGGGGAGGGGAGAAGAGG + Intronic
1038681835 8:29675808-29675830 AAGCTGGTGGTGGTGAGAATTGG + Intergenic
1038857117 8:31346040-31346062 GAAATGGAGCTAGGGAAAATGGG - Intergenic
1039317284 8:36387731-36387753 GAGGAGGAGGAGGGGAAAATGGG - Intergenic
1039364672 8:36917334-36917356 AAGAAGTTGGTGGGGAAAATGGG - Intronic
1039624931 8:39039547-39039569 ATGGTGGAGGTGGAGGAAATGGG - Intronic
1040589390 8:48776382-48776404 AACATGGAGCTTGGGAAAAGAGG - Intergenic
1041059173 8:54019736-54019758 ATGATGCAGTTGGGGAAAAGAGG + Intronic
1041796891 8:61754336-61754358 AAGAGGGAGGAGGGGAAAGAAGG - Intergenic
1042685839 8:71439362-71439384 AAGTTGGAGGTGGGGGTAAAGGG + Intronic
1042899994 8:73715558-73715580 AACAAGTATGTGGGGAAAATGGG + Intronic
1043426028 8:80149677-80149699 CAGATGGAGGTGAGGAACTTGGG + Intronic
1044647257 8:94457229-94457251 AAGGAGGAAGTGGGGAAAATAGG + Intronic
1044783495 8:95769223-95769245 AAGTTGGAGGTGGGAAAAACGGG + Intergenic
1044823377 8:96174062-96174084 AAGAAGGGGGTAGGGAAATTGGG - Intergenic
1045185755 8:99836417-99836439 GGGATGGAGGAGGGGAGAATGGG - Intronic
1045498850 8:102729878-102729900 AAGGCGGAGATGTGGAAAATGGG - Intergenic
1046738795 8:117806710-117806732 AAGGTGGAGATGGGGCAGATTGG - Intronic
1047019628 8:120761132-120761154 AAAATGGAGGTGGTGGTAATGGG - Intronic
1047068995 8:121321387-121321409 GAGATGGAGGAGGTGAAACTGGG + Intergenic
1047184870 8:122623867-122623889 AAGAAGGAGATGAGGAAACTTGG - Intergenic
1047238539 8:123063952-123063974 AGAATAGAGGTGTGGAAAATAGG + Intronic
1047388943 8:124434339-124434361 CAGATAGAGGGGGGAAAAATAGG - Intergenic
1047627320 8:126669338-126669360 AATCTGGAGGTGAGAAAAATTGG + Intergenic
1048637694 8:136316375-136316397 AGCTGGGAGGTGGGGAAAATGGG - Intergenic
1048884701 8:138900449-138900471 AAGAAGGAGGTTCGGAAAACAGG - Intronic
1049212779 8:141394429-141394451 AGGGTGGAGGTGGGGAGAAACGG - Intronic
1049971599 9:826593-826615 GGGATGGAGGTGGGGAAATGCGG - Intergenic
1050047025 9:1557638-1557660 GATATGGAGGTGGTGAAAAGTGG + Intergenic
1050134753 9:2450150-2450172 AAGATGTAGGCTGGGAAACTAGG - Intergenic
1050673990 9:8031050-8031072 AATATGGAGGTTGAGGAAATGGG - Intergenic
1051005974 9:12345113-12345135 AGGTTGGAGGTGGGGTAATTAGG + Intergenic
1051077744 9:13260358-13260380 AATATGGAGGTAAGGAAGATGGG + Intronic
1051112931 9:13660846-13660868 AAGATGGTGGGGGGCAGAATTGG - Intergenic
1051261110 9:15265641-15265663 AAAAGGGAGGAGGGGAAAAAGGG + Intronic
1051613123 9:18980892-18980914 AAAATGGAGGTGGGAAAGAATGG - Intronic
1051663389 9:19445881-19445903 TAGATGGAGGTGGTGGAAAGAGG + Intronic
1051763203 9:20492137-20492159 AAGATGGAGGTTTTAAAAATAGG - Intronic
1052690254 9:31808279-31808301 AAGTTAGAGGTGGGCATAATTGG + Intergenic
1053401439 9:37827220-37827242 AAGTTGGAGGTGGGGATAAATGG + Intronic
1053625180 9:39862790-39862812 AAGAAGAAAGTGGGGTAAATGGG - Intergenic
1053879691 9:42580436-42580458 AAGAAGAAAGTGGGGTAAATGGG + Intergenic
1053892976 9:42713883-42713905 AAGAAGAAAGTGGGGTAAATGGG - Intergenic
1054218714 9:62387904-62387926 AAGAAGAAAGTGGGGTAAATGGG + Intergenic
1054232002 9:62521263-62521285 AAGAAGAAAGTGGGGTAAATGGG - Intergenic
1054696892 9:68369554-68369576 AAAATGGAGGTGGTGAAAATTGG - Intronic
1055284499 9:74713987-74714009 AAGATGAAGGTGGAAAGAATGGG - Intergenic
1055360222 9:75481640-75481662 AAGATGGATATTTGGAAAATGGG + Intergenic
1055589469 9:77796358-77796380 AAGATGGATGTGTGCAATATTGG - Intronic
1055746378 9:79450020-79450042 AGTATGGAAGTGGGGAAAAAGGG - Intergenic
1056106407 9:83351074-83351096 AAGATGAATTTGGGTAAAATAGG - Intronic
1057295617 9:93836771-93836793 AAGGTGGAGGTGGGAGAAAAGGG - Intergenic
1057314737 9:93960974-93960996 AAGAAAGAGGAGGGGGAAATGGG - Intergenic
1057415730 9:94860567-94860589 AGGGTGCTGGTGGGGAAAATTGG + Intronic
1057554899 9:96080235-96080257 AAGTAGGAGTTAGGGAAAATAGG - Intergenic
1057767474 9:97934705-97934727 GTTATGGAGGTGGGGCAAATAGG + Intronic
1058009990 9:99966286-99966308 AAGATAGTGGTGGAGAATATTGG + Intronic
1058604617 9:106707211-106707233 GAGGTGGAGGTGGGGGCAATTGG + Intergenic
1058757333 9:108095473-108095495 AAGATGGACGTGGGGAAGCAGGG - Intergenic
1060499915 9:124145387-124145409 AAGATGGAGTTGGTTAAATTAGG - Intergenic
1062467942 9:136689465-136689487 AAGAGGGAGGAGGTGAAATTAGG - Intergenic
1203377013 Un_KI270442v1:384491-384513 AAGATGGAGGGAGGGAGAAAGGG - Intergenic
1185604396 X:1359526-1359548 AAGATAGAGGGAGGGAAAAAGGG - Intronic
1185604497 X:1360155-1360177 AAGATGGAGGGAGGGAGAAAGGG - Intronic
1185622505 X:1461255-1461277 AAGATGGAGGCTGGGAAGCTAGG - Intergenic
1186898763 X:14031534-14031556 AAGATGGAGAGGGGTAAGATAGG + Intergenic
1187155558 X:16717813-16717835 AGGATGGGGGTGGGGGGAATGGG - Intergenic
1188144043 X:26587513-26587535 AAAATGGAGGTGGGTGACATAGG - Intergenic
1188584914 X:31762204-31762226 AAAATGGAAGAAGGGAAAATGGG - Intronic
1188908163 X:35812991-35813013 GAGAGGGAGGTGGGAAAATTAGG + Intergenic
1189191161 X:39107357-39107379 AGGTTGGATATGGGGAAAATGGG - Intergenic
1189523978 X:41800359-41800381 GAGTAGGAGCTGGGGAAAATGGG - Intronic
1189758434 X:44296152-44296174 AGGATGGAGGTGGAGAAAAGTGG + Intronic
1190287766 X:48972027-48972049 AGGAAGGAGGTGGAGAGAATTGG - Intergenic
1190584247 X:51922184-51922206 AAGATGGAGGTGATGAAGATTGG - Intergenic
1192036645 X:67569876-67569898 CACATGGAGATGGGGACAATAGG - Intronic
1192264615 X:69530053-69530075 AAGGTGGGGGCGGGGGAAATGGG + Exonic
1192368652 X:70495903-70495925 CAGATGCAGGTTGGGAAAAAGGG - Intronic
1192592229 X:72369914-72369936 AGGATGGAGGTGGGGATTAGGGG + Intronic
1192917573 X:75669443-75669465 AAGTTGGGTGAGGGGAAAATGGG - Intergenic
1193369453 X:80676980-80677002 AAGAGGCAGATGGGGAAGATGGG - Exonic
1193625289 X:83813073-83813095 AAGCTGGAGGTGGGGAGGAGGGG - Intergenic
1194827430 X:98579869-98579891 AGCATGGAGGTGGTGAAAAGGGG - Intergenic
1195064802 X:101231324-101231346 AGGGTGGAGGTGGGCAAGATGGG - Intronic
1195856812 X:109340572-109340594 AAGATGGGGGTGGGGAAAACAGG + Intergenic
1196464588 X:115959103-115959125 AAGATGGAAGAGGGGAAGAGGGG + Intergenic
1197077508 X:122370439-122370461 AAAAAGGAGGTGGGGAAAAGTGG + Intergenic
1200927519 Y:8667900-8667922 AACATGGAAGTGAGGAAAAGAGG - Intergenic
1202377417 Y:24250253-24250275 AGGATGGAGGTGGGGAAGAGAGG - Intergenic
1202493363 Y:25419868-25419890 AGGATGGAGGTGGGGAAGAGAGG + Intergenic