ID: 952963547

View in Genome Browser
Species Human (GRCh38)
Location 3:38607615-38607637
Sequence GTCACAGAGGGCCACCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952963547_952963551 -1 Left 952963547 3:38607615-38607637 CCTTTGAGGTGGCCCTCTGTGAC 0: 1
1: 0
2: 3
3: 12
4: 127
Right 952963551 3:38607637-38607659 CCCCCTTCTCCAACACTCCATGG 0: 1
1: 0
2: 5
3: 25
4: 252
952963547_952963557 19 Left 952963547 3:38607615-38607637 CCTTTGAGGTGGCCCTCTGTGAC 0: 1
1: 0
2: 3
3: 12
4: 127
Right 952963557 3:38607657-38607679 TGGCACTGTCACAGTGATCCAGG 0: 1
1: 0
2: 0
3: 10
4: 170
952963547_952963558 25 Left 952963547 3:38607615-38607637 CCTTTGAGGTGGCCCTCTGTGAC 0: 1
1: 0
2: 3
3: 12
4: 127
Right 952963558 3:38607663-38607685 TGTCACAGTGATCCAGGCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952963547 Original CRISPR GTCACAGAGGGCCACCTCAA AGG (reversed) Intronic
900606978 1:3528096-3528118 GACACAGCGAGCCAGCTCAAGGG + Intronic
901502734 1:9663434-9663456 GACCCAGATGGCCATCTCAAGGG + Intronic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
905301927 1:36991478-36991500 GTCCCAGAGGGTCACCTCCATGG + Intronic
905691435 1:39946042-39946064 GACACAGGTGGCCACCTCTAGGG + Intergenic
910900033 1:92110533-92110555 GTTACAGAGGTCCACAACAAGGG - Intronic
912878712 1:113388844-113388866 GACACACAGGGCCACCTGACAGG - Intergenic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
916807048 1:168269378-168269400 TCCACAGGGGGCCACCTCATGGG - Intergenic
921257266 1:213353930-213353952 GGCACAGAGGGCCATCTCAGAGG + Intergenic
921447003 1:215258753-215258775 GTCATAGAGGGTCTCCTCATAGG + Intergenic
922233671 1:223707190-223707212 GTCTCAGAGGGCCATGGCAATGG - Intronic
924537282 1:244946402-244946424 ATCACTGAGGGCCACCCCAGAGG + Intergenic
924758280 1:246961919-246961941 GGCATAGAGAGGCACCTCAATGG + Intronic
1067538613 10:47135617-47135639 TTCACAGTGGGCCACCCCAAAGG + Intergenic
1067758991 10:49029104-49029126 TTGACAGAGGGTCTCCTCAATGG + Intronic
1071416653 10:85447937-85447959 GGCACAGAGAGCCACCTCTAGGG + Intergenic
1075823111 10:125331042-125331064 TTCACTCAGGGCCACCCCAAGGG + Intergenic
1075991529 10:126842694-126842716 GACAGAGTGGGCCACTTCAAAGG + Intergenic
1079088088 11:17461511-17461533 GTCACAGAGAGGGACCTCAAAGG - Intronic
1079340363 11:19606655-19606677 CCCACAGAGGGGGACCTCAAAGG + Intronic
1081664767 11:44910344-44910366 GCCACATAGGTCCACCTCCAGGG + Intronic
1086071633 11:82805908-82805930 GTTACGGAGGTCCACCTCGAAGG + Intergenic
1089176446 11:116552209-116552231 GTCCCAGGTGCCCACCTCAATGG + Intergenic
1089726556 11:120485675-120485697 TTCTCTGAGGGTCACCTCAAAGG + Exonic
1090830922 11:130420388-130420410 CTCAAAGAGGGCCACTTCAAGGG - Intronic
1098184166 12:67878718-67878740 GACTCAGGTGGCCACCTCAAGGG - Intergenic
1098308712 12:69126721-69126743 GTCAACCAGGGCCACCTCATAGG - Intergenic
1100219750 12:92492191-92492213 GTAACAGAGACCCAGCTCAATGG + Intergenic
1101124753 12:101620533-101620555 GTCACAGAGGGCCATGTGTAGGG + Intronic
1103173857 12:118844705-118844727 GTCACTGAGGACCATCTCAGAGG + Intergenic
1103866226 12:124054122-124054144 AACAGAGAGGGCCACTTCAAAGG - Intronic
1103968859 12:124656927-124656949 GGCACAGAGTGACAGCTCAATGG - Intergenic
1104001147 12:124861427-124861449 GACACAGAGGGCCAACTGTAGGG + Intronic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1114526623 14:23370611-23370633 GTCCTAGAGGGACACCCCAAAGG + Intergenic
1118824585 14:69368682-69368704 ATCACTGGGGGCCACCTCAGAGG + Intergenic
1119998467 14:79278416-79278438 GTCACAGATGGCCACGACAGAGG + Intronic
1121230240 14:92352241-92352263 GTGAGAGAGAGCCACCCCAAAGG + Intronic
1124167363 15:27339869-27339891 GTCACGCAGGGTCACCTAAATGG - Intronic
1127685550 15:61340149-61340171 GTCACTGAGGGCCACCTTCTTGG - Intergenic
1128984248 15:72207707-72207729 GTTGGAGTGGGCCACCTCAAAGG - Intronic
1131732528 15:95296847-95296869 GTCACAGAGGGAAACTTGAATGG + Intergenic
1133562906 16:6966223-6966245 CTCACATAGGGCCACATCCAGGG + Intronic
1134803868 16:17108588-17108610 TTCACAGAGGGCCTCCCCCAGGG + Exonic
1135743601 16:24997640-24997662 GGCACAGAGAGCCACTGCAAAGG + Intronic
1135965216 16:27029844-27029866 GTCACTGGGGGCCACCTCGGGGG - Intergenic
1138116827 16:54367550-54367572 GTCACAGAGTGCCACCTAAATGG - Intergenic
1141919551 16:87126890-87126912 GGCGCAGAGGGCCACCTACAAGG - Intronic
1143671569 17:8399641-8399663 GTCCCAGAGGGCCGCCACAGTGG - Intergenic
1144568799 17:16381948-16381970 GTCACTGGGCTCCACCTCAAGGG - Exonic
1146265870 17:31452352-31452374 GTCTCCGAGGACCAGCTCAAAGG + Intronic
1150677308 17:67255526-67255548 GTCACAGATGGCCACCATATTGG + Intergenic
1151345027 17:73496176-73496198 GTCACAGATGGCTCCATCAATGG - Intronic
1152170144 17:78740481-78740503 GGCACAGCAGGCCACCTCATAGG + Intronic
1152582641 17:81173383-81173405 GGCCCAGTGGGCCACCTCCATGG + Intergenic
1152676821 17:81645461-81645483 GCCCCAGAGGGCCACCACCAGGG - Exonic
1152943286 17:83184026-83184048 GCCACAGAAGGCCTCCTCACAGG + Intergenic
1162886327 19:13700162-13700184 GTGACTGAGGGTCACCTCCAGGG - Intergenic
1163323183 19:16586519-16586541 CCCACACAGGGCCACCTCCACGG + Intronic
1164575286 19:29402156-29402178 TTCTCAGAGGGCCACCCCATCGG + Intergenic
1168195701 19:54772206-54772228 GTCACAGGGGTCCACATGAAAGG + Intronic
929714915 2:44300301-44300323 GTCACTGAAGGACTCCTCAAGGG - Intronic
932921515 2:75920476-75920498 GTCACAGAGGGGCACTTACAAGG - Intergenic
935962820 2:108444155-108444177 GTCTCAGAAGACCACCTAAATGG - Intergenic
937227735 2:120379299-120379321 GGCAGACAGGGCCACTTCAAGGG + Intergenic
938064960 2:128276942-128276964 GTGAAGGAGGACCACCTCAAGGG + Intronic
943724316 2:191237287-191237309 GGCAATGAGGGCCACTTCAAAGG - Intergenic
944863852 2:203841246-203841268 GTGACAGAGGGACACCTCCCAGG - Intergenic
948538234 2:238663939-238663961 GCCCCAGAGGACCACCTGAACGG - Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1172196084 20:33092497-33092519 GACACAGCTGGCCACCCCAATGG - Exonic
1172448855 20:35007812-35007834 CTCACAGAGAGCCAGCTCAGTGG + Intronic
1173397038 20:42689415-42689437 CTCACTGAGAGCCACCTCCACGG + Intronic
1175121323 20:56718283-56718305 GTCCCAGATGGGCACCTCCAGGG - Intergenic
1175503961 20:59469107-59469129 GTCACCCAGGGCCCCCTCCAGGG - Intergenic
1178051505 21:28752860-28752882 GACACAGAGGGCCACGGCAGAGG + Intergenic
1178846452 21:36177808-36177830 GTTACAGAGGCCAAGCTCAAGGG - Intronic
1179058126 21:37954766-37954788 GACACAGGCGGCCACCTCGAGGG - Intronic
1179960503 21:44764830-44764852 GTGACATGGGGCCACCTCCAGGG - Intergenic
1181514667 22:23403756-23403778 GTCCCTCAGGGCCACCTCCATGG - Intergenic
949555801 3:5151549-5151571 GTCACAGAAGGAAGCCTCAAGGG - Intronic
951907719 3:27721238-27721260 GACACAGAGGGACACCGCATTGG + Intronic
952963547 3:38607615-38607637 GTCACAGAGGGCCACCTCAAAGG - Intronic
953192529 3:40701180-40701202 GTCACAGAGAGTCACCACTAGGG + Intergenic
953815722 3:46154618-46154640 ATGACAGATGGCCACCACAAAGG + Intergenic
961347595 3:126274212-126274234 GGCACAGAGGGTCACTGCAAGGG - Intergenic
964763867 3:160159492-160159514 CTCAGAGAGGGCCTCTTCAATGG + Intergenic
966826720 3:183971054-183971076 GTCTCAGAGGGCCTCCTATAGGG - Intronic
967215879 3:187209890-187209912 TTGACAGAGGACCAGCTCAATGG + Intergenic
967240702 3:187436606-187436628 GCCACAGAGGACCCCCTCACAGG - Intergenic
967603315 3:191414925-191414947 CTCAAAGAGGGCCACCTAGAGGG - Intergenic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
973140466 4:46761277-46761299 GTAGCAGGGGGCCACCTAAATGG + Intronic
974329477 4:60458913-60458935 GTCTCAGATGGCCACCTGACAGG - Intergenic
975661698 4:76695228-76695250 GTCAGAGAGGACCACCTCACAGG - Intronic
977237756 4:94528948-94528970 CTGACAGAGGGCCACCACACTGG - Intronic
977256142 4:94742075-94742097 GCCACACAGGGCTACCTCTAGGG + Intergenic
986553522 5:8985039-8985061 GCCACAAAGGGGCAGCTCAAGGG - Intergenic
986865547 5:11982147-11982169 ATCACAGCGGGCCACCTCAGAGG - Intergenic
988049060 5:25999825-25999847 GTAACACTGGTCCACCTCAAAGG - Intergenic
990295675 5:54399107-54399129 GTCACGGAGGTCCACCTCCTGGG + Intergenic
990816820 5:59795141-59795163 GTCACAGAGGGTAAAGTCAATGG + Intronic
993190374 5:84672690-84672712 GACACAGGTGGACACCTCAAGGG - Intergenic
994050816 5:95359981-95360003 GACCTAGAGGGGCACCTCAAGGG + Intergenic
994784212 5:104134523-104134545 TACACAGAGAGCCACCTCAATGG - Intergenic
997288169 5:132699272-132699294 GTGAGAAAGGTCCACCTCAAAGG + Exonic
998710438 5:144818732-144818754 GTCACAAAGGGTCCCCTCTAAGG - Intergenic
1000330094 5:160199307-160199329 GTCACAGAGAGACAGCTGAAAGG - Intronic
1001913270 5:175538797-175538819 GCCACAGATGTTCACCTCAAGGG - Intergenic
1005932457 6:30493770-30493792 GCCACAGAGGGCCCCCACCAGGG + Exonic
1007522290 6:42460227-42460249 GTAAGAGAGGCCCACCTAAAAGG + Intergenic
1008897955 6:56579578-56579600 GGAAATGAGGGCCACCTCAATGG + Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1012784712 6:103609098-103609120 GGCACAGAGGGCCAAATCAGAGG + Intergenic
1016560654 6:145392281-145392303 GTCTCCGATGGCCTCCTCAAAGG + Intergenic
1017818618 6:158032711-158032733 TTCACATAGGGTCACTTCAAGGG + Intronic
1017916490 6:158835716-158835738 GTCACAGAGCCCCACCTCCCGGG + Intergenic
1018386696 6:163310840-163310862 GTCACCGAGGGCCACCGCAATGG - Intronic
1021851942 7:24817041-24817063 GTCAGAAAGGGCCATCTAAATGG + Intronic
1023053396 7:36272814-36272836 GTCACAGTGTGCCACTTGAAGGG - Intronic
1027373444 7:77531288-77531310 GTCACAGAGGTAGACCTTAAAGG - Intergenic
1030811321 7:113975630-113975652 GTCACTGAGGGCCCCCACAATGG - Intronic
1032387327 7:131533737-131533759 GTTACAGAGGGGCACCTCTGAGG - Intronic
1032650928 7:133877648-133877670 GCCAGAGAGGACTACCTCAATGG - Intronic
1033133941 7:138769034-138769056 GTCCCAGAGGCCCACCTGGAGGG - Intronic
1036779061 8:11633394-11633416 GCCACAGAGGGGAATCTCAAAGG - Intergenic
1038423086 8:27446048-27446070 GTCACAGAGTGCCACCTCAGTGG - Intronic
1039777360 8:40750357-40750379 GTCACAGGGGGTCACCTAATAGG + Intronic
1039792787 8:40888760-40888782 GACCCAGAGGGCCACCTCGGGGG + Intronic
1052605176 9:30689670-30689692 GTTACGGAGGTCCACCTCGAAGG + Intergenic
1056250402 9:84742320-84742342 CTCACAGATGGGAACCTCAAAGG + Intronic
1059517973 9:114913443-114913465 GTCACAGAGGGCCACACGCATGG - Intronic
1060050201 9:120373250-120373272 TTCACTGGGGGCCATCTCAAAGG - Intergenic
1061680412 9:132240260-132240282 GTCACAGGGGGCCAGCTGCAGGG + Intronic
1186256494 X:7727189-7727211 GTGACATAGGGCCACATCACAGG + Intergenic
1190705933 X:53028214-53028236 GACCCAGGTGGCCACCTCAAAGG - Intergenic
1191892298 X:65956608-65956630 GTTACCGAGGTCCACCTCGAAGG - Intergenic
1192381192 X:70618370-70618392 GACCCAGGGGGCCGCCTCAAGGG - Intronic
1194074366 X:89370080-89370102 GTAAGAGAGGGCTACCTGAAAGG - Intergenic
1194123673 X:89989368-89989390 GTCACAGAGGGGGGTCTCAAAGG - Intergenic
1201543269 Y:15132274-15132296 GTCCCAGAGGGGCACCTGACAGG - Intergenic