ID: 952965043

View in Genome Browser
Species Human (GRCh38)
Location 3:38615939-38615961
Sequence CTGCTGTCCTTAGCCACACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952965043_952965044 -8 Left 952965043 3:38615939-38615961 CCGGGTGTGGCTAAGGACAGCAG 0: 1
1: 0
2: 1
3: 17
4: 182
Right 952965044 3:38615954-38615976 GACAGCAGCTCCCCTTGCCTAGG 0: 1
1: 0
2: 1
3: 24
4: 251
952965043_952965051 27 Left 952965043 3:38615939-38615961 CCGGGTGTGGCTAAGGACAGCAG 0: 1
1: 0
2: 1
3: 17
4: 182
Right 952965051 3:38615989-38616011 CGGCTGTCTCTTCTAGTTACAGG 0: 1
1: 0
2: 0
3: 6
4: 64
952965043_952965049 7 Left 952965043 3:38615939-38615961 CCGGGTGTGGCTAAGGACAGCAG 0: 1
1: 0
2: 1
3: 17
4: 182
Right 952965049 3:38615969-38615991 TGCCTAGGATACTGGTTTCGCGG 0: 1
1: 0
2: 0
3: 9
4: 63
952965043_952965045 -1 Left 952965043 3:38615939-38615961 CCGGGTGTGGCTAAGGACAGCAG 0: 1
1: 0
2: 1
3: 17
4: 182
Right 952965045 3:38615961-38615983 GCTCCCCTTGCCTAGGATACTGG 0: 1
1: 0
2: 0
3: 4
4: 101
952965043_952965052 28 Left 952965043 3:38615939-38615961 CCGGGTGTGGCTAAGGACAGCAG 0: 1
1: 0
2: 1
3: 17
4: 182
Right 952965052 3:38615990-38616012 GGCTGTCTCTTCTAGTTACAGGG 0: 1
1: 0
2: 0
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952965043 Original CRISPR CTGCTGTCCTTAGCCACACC CGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900649158 1:3722586-3722608 CAGCTGGCCTGAGCCTCACCTGG + Intronic
901207697 1:7506225-7506247 CTGCTCTCCTTTGCCACACCTGG - Intronic
901783250 1:11608484-11608506 CAGCTGTCCTGAGCCACAGGGGG - Intergenic
902338008 1:15764951-15764973 ACTCTGTCCCTAGCCACACCAGG + Exonic
905010164 1:34741838-34741860 CTGCTGGCCTTCACCCCACCTGG - Intronic
905905764 1:41617443-41617465 TTGCTGTCCTCAACCACCCCAGG - Intronic
908734015 1:67257028-67257050 GTGCTGTTCTTACCCAAACCTGG + Intronic
909037408 1:70609665-70609687 CTGCTGCACTTCACCACACCTGG + Intergenic
917271248 1:173277047-173277069 CTGCTGGCCTTACAGACACCTGG - Intergenic
917704497 1:177618344-177618366 CTGCTGTCTTTGGACATACCAGG - Intergenic
918712324 1:187747190-187747212 CTGCTGCCATTAGCCAGACTAGG + Intergenic
920737070 1:208542543-208542565 CTGCTGTCCATATCCAAAGCAGG - Intergenic
921796841 1:219355146-219355168 CAGTAGTCCTTAGCCACACTAGG + Intergenic
924598749 1:245469607-245469629 TAGCTGTGCTTAGCCCCACCTGG - Intronic
1063838865 10:10047736-10047758 ATGTTGTCCTCACCCACACCAGG + Intergenic
1065207999 10:23375286-23375308 CAGCTGTCCTTGGCCATTCCTGG - Intergenic
1068928462 10:62564354-62564376 CAGCTGTCCAGAGCCACAGCTGG + Intronic
1069807227 10:71133614-71133636 CTCCTTCCCTGAGCCACACCAGG + Intergenic
1070240520 10:74675632-74675654 CTGCTGTGCTTTGTCACAGCAGG + Intronic
1070625300 10:78046865-78046887 CTGCTGTCCAGGACCACACCTGG - Intronic
1070653091 10:78252162-78252184 CTGCTGACCTTGGCCACCCAGGG - Intergenic
1073998454 10:109342557-109342579 CGCCAGTCCTTAGCCACAGCTGG + Intergenic
1075744330 10:124716093-124716115 CTGCTGTCCTTAGACAGAGAGGG + Intronic
1077116579 11:887838-887860 CTCATGGCCTTGGCCACACCAGG + Intronic
1077481775 11:2818370-2818392 GTGGGGGCCTTAGCCACACCTGG - Intronic
1079375223 11:19886471-19886493 CTGCTTTCCCTAACAACACCAGG + Intronic
1079639034 11:22781147-22781169 CTGCTGTCCTTTGGCAAACAAGG + Intronic
1079664048 11:23081656-23081678 CAGGTGTCCTTCACCACACCAGG - Intergenic
1081080155 11:38731635-38731657 CTGCTGTCTTCAGAGACACCAGG + Intergenic
1083292453 11:61697441-61697463 CTCCTGTCCTTGGCACCACCTGG - Intronic
1083554248 11:63613678-63613700 CTGCCCTCCGGAGCCACACCCGG - Intronic
1083990809 11:66244641-66244663 CTGCTGTCCTGAGCGTCTCCTGG + Exonic
1085458480 11:76679066-76679088 CTGCTGGCCTTGGCTTCACCTGG + Intergenic
1087117413 11:94540618-94540640 CTGCTGTCATTGGCCAAACCTGG - Intergenic
1087514999 11:99147624-99147646 CTGCTGTCCTTTTCCCTACCAGG + Intronic
1089711034 11:120314928-120314950 CTGCTGTCCTCAGCAAAAGCAGG + Intronic
1091748510 12:3008344-3008366 TTGCTGTCCTGAAACACACCAGG - Intronic
1093590594 12:20897180-20897202 CTGCTGTCCTTTGTCAAAGCAGG + Intronic
1097852581 12:64427260-64427282 CAGGTGTCCATCGCCACACCCGG + Intronic
1101061200 12:100974279-100974301 CAGCTGTACATAACCACACCGGG - Intronic
1102000176 12:109552652-109552674 ATGCTGTCCTCAGCGTCACCTGG + Intergenic
1106346649 13:28886059-28886081 CTGCTGTTCTGTGCCACACCAGG - Intronic
1107651997 13:42554186-42554208 CAGGTGTCCATAGCCACACATGG + Intergenic
1107825300 13:44324023-44324045 CTGCTTTCCTGAACCACTCCTGG + Intergenic
1111002070 13:82197584-82197606 CGGCTGTTTTCAGCCACACCTGG + Intergenic
1112051757 13:95649810-95649832 ATGGTGGCCTGAGCCACACCTGG + Intergenic
1113121162 13:106924942-106924964 CTGCAGTCCTTGGCCACCCCAGG - Intergenic
1113572159 13:111365822-111365844 CTGATGTGCTGAGCTACACCCGG + Intergenic
1113816568 13:113175802-113175824 CTGCTCTCCTAAGTCACACCCGG - Intergenic
1114283235 14:21214438-21214460 TTCCTGTCCATAGCCACTCCTGG - Intronic
1115258364 14:31426884-31426906 CTGCTGTCCCTGGCCACTGCAGG - Intronic
1116817576 14:49598474-49598496 CTGCTCTCCGGAGGCACACCTGG - Intronic
1118616164 14:67575810-67575832 CTGCTGTCCACAGCGACCCCTGG + Exonic
1119729538 14:76942216-76942238 CTGCTGTCCTTAGCCAGCAGAGG + Intergenic
1120328466 14:83057521-83057543 ATGCTGTCCTAAGTCTCACCTGG + Intergenic
1121573737 14:94966774-94966796 CAGCTGTCCTTAGAAACATCTGG - Intergenic
1121693577 14:95894874-95894896 CTCCTGTCCTCAGCCACAGGTGG + Intergenic
1122171364 14:99877975-99877997 AAGCTGTCCTGAGCCACACAAGG - Intronic
1123132405 14:105999473-105999495 CTGGTGTCCTGAGCCCCCCCTGG + Intergenic
1123132680 14:106000557-106000579 CTGGTGTCCTGAGCCCCTCCTGG + Intergenic
1123132717 14:106000715-106000737 CTGGTGTCCTGAGCCCCTCCTGG + Intergenic
1123132741 14:106000796-106000818 CTGGTGTCCTGAGCCCCTCCTGG + Intergenic
1123132784 14:106000974-106000996 CTGGTGTCCTGAGCCCCTCCTGG + Intergenic
1123132808 14:106001055-106001077 CTGGTGTCCTGAGCCCCTCCTGG + Intergenic
1123132832 14:106001136-106001158 CTGGTGTCCTGAGCCCCTCCTGG + Intergenic
1123132856 14:106001217-106001239 CTGGTGTCCTGAGCCCCTCCTGG + Intergenic
1123132880 14:106001298-106001320 CTGGTGTCCTGAGCCCCTCCTGG + Intergenic
1123132904 14:106001379-106001401 CTGGTGTCCTGAGCCCCTCCTGG + Intergenic
1123203533 14:106691437-106691459 CTGCTGTCCTGAGCACCCCCTGG + Intergenic
1123203631 14:106691825-106691847 CTGCTGTCCTGAGTGCCACCTGG + Intergenic
1123582931 15:21731825-21731847 CTGGTGTCCTGAGCCCCTCCTGG + Intergenic
1123619581 15:22174421-22174443 CTGGTGTCCTGAGCCCCTCCTGG + Intergenic
1127805121 15:62512089-62512111 CTGCTGTCCTGGGTCACAGCTGG + Intronic
1128596730 15:68958933-68958955 CTCCTGTATTTAACCACACCAGG + Intronic
1129846297 15:78769136-78769158 CTGCTCTCCATCCCCACACCAGG + Intronic
1132215209 15:100057356-100057378 GTGCTGACCACAGCCACACCAGG + Intronic
1138197217 16:55060530-55060552 TTGCTGTCCTCAAGCACACCAGG + Intergenic
1139440927 16:66966434-66966456 CTGCTGTCCCCAGCCCCACCTGG - Intronic
1139489158 16:67277504-67277526 CTGCTGTGGTCAGCCACCCCTGG + Exonic
1141444774 16:84050794-84050816 CTGCTCTCCTTACCCACATGGGG - Intergenic
1141445013 16:84052073-84052095 CAGCTGTCCTTACCCACATGGGG - Intergenic
1141894050 16:86947196-86947218 CTGGTGTCCTTGGCCACCTCAGG + Intergenic
1142176664 16:88648351-88648373 GGGCTGTCCTTGGCCACTCCTGG - Intronic
1142868791 17:2807591-2807613 CTGCTGACCTTACGCACCCCTGG - Intronic
1143129856 17:4671355-4671377 CTTCTGCCTTTTGCCACACCTGG - Intergenic
1146480182 17:33198700-33198722 TTGCTGGCTTTAGCCACACAGGG - Intronic
1146564515 17:33900886-33900908 CTGCTGTCTTTAGCCAAGGCTGG - Intronic
1146704172 17:34988270-34988292 ATGCTGTCCTTATCATCACCTGG - Intronic
1148241797 17:46004104-46004126 GTGCTGTGCTTTGCCTCACCAGG - Intronic
1148895844 17:50838643-50838665 TTGCTGACCTTTGCCACACAAGG + Intronic
1152798525 17:82320492-82320514 ATGCTGTCCTCAGACACACCAGG - Intergenic
1157564497 18:48670665-48670687 CAGCTTCCCTTTGCCACACCTGG - Exonic
1160860245 19:1234552-1234574 CTGCTGCCCATAGGCTCACCTGG + Exonic
1164811488 19:31160312-31160334 GTGCTGTTCTTAGACACAACTGG + Intergenic
1164829650 19:31310687-31310709 GTTCTGTCCTGAGCCACAGCAGG + Intronic
1166165277 19:40983504-40983526 ATCCTGTCCTTTGCAACACCAGG + Intergenic
1166309677 19:41955958-41955980 CTGCTGTCCTTAGACAGGCCTGG + Intergenic
1166381410 19:42357120-42357142 CTGTTGTCCTGAGCCAGTCCTGG + Intronic
1168501147 19:56894614-56894636 CTGCTCTCCTGGGCCAGACCTGG + Intergenic
929289914 2:40178328-40178350 CTGCTGGCCTGTGCCACCCCTGG - Intronic
929607481 2:43244596-43244618 CTGCTGTCCCTTCACACACCAGG - Intronic
932732931 2:74233219-74233241 CTGGTGGCCTTACCCACATCTGG + Intronic
933300061 2:80531135-80531157 CTGCTGTCCTTGACCGCACCAGG - Intronic
934747078 2:96766379-96766401 TTGCTGTTCTTAAACACACCAGG + Intronic
936558969 2:113520038-113520060 CTTCTGTCCTTAGACCCAGCTGG - Intergenic
936754480 2:115689896-115689918 CTGCTGCCCTTGGACACCCCAGG - Exonic
937440041 2:121907720-121907742 CTGGTGTGCTAAGCCACAGCTGG + Intergenic
937985903 2:127637990-127638012 CTTCTGTCCTTCTCCCCACCCGG + Intergenic
938068214 2:128293079-128293101 CTGCTCTGCTCCGCCACACCAGG + Intronic
944222946 2:197320497-197320519 CTGCTCTCCTCATCCCCACCAGG + Intergenic
946053782 2:216884261-216884283 CTGCTGGCCTCAGCCACAGAAGG - Intergenic
946341969 2:219075733-219075755 CTGCTTTCCTTTGCCAAACTTGG - Exonic
948063119 2:235056490-235056512 CTGTTGTCCTTAGCCATGCAGGG - Intergenic
948217113 2:236240016-236240038 CTGCTGTCCTGTGGTACACCTGG - Intronic
1169566683 20:6861680-6861702 TTGCTCTCCTGAGCCACACATGG + Intergenic
1172705213 20:36877857-36877879 CTCCTGTCCCTGGACACACCAGG + Intronic
1173611865 20:44374287-44374309 GTCGTGTCCTTTGCCACACCAGG - Intronic
1175976058 20:62711045-62711067 CTGCTGCCCTCACCCCCACCGGG - Intronic
1176176673 20:63730296-63730318 CTACTGTTCTTAGGCACACAGGG - Intronic
1177736837 21:25101519-25101541 CTGCTGTCCTTCTCCACATTGGG - Intergenic
1177917390 21:27106685-27106707 GTTTTGTTCTTAGCCACACCTGG + Intergenic
1178512352 21:33216074-33216096 CTGCCCTCCTTAGCCACCCCAGG - Intergenic
1179797589 21:43794400-43794422 CTGCTGGACTCAGCCACACAAGG - Intronic
1179992155 21:44953676-44953698 CTGGCCTCCTGAGCCACACCTGG - Intronic
1180023155 21:45142051-45142073 TGGGTGTCCTTAGCCACCCCCGG + Intronic
1180868548 22:19133445-19133467 CTGCTGGCCCTGGCCTCACCTGG - Exonic
1182284652 22:29238392-29238414 CTACTGTCATGTGCCACACCTGG + Intronic
952965043 3:38615939-38615961 CTGCTGTCCTTAGCCACACCCGG - Intronic
953371240 3:42390322-42390344 CCTCTTTCCCTAGCCACACCTGG + Intergenic
956097874 3:65736564-65736586 GTGCTGCCCTTACCCACCCCAGG - Intronic
960426938 3:117520387-117520409 ATGCAGTACTTAGCCACTCCAGG - Intergenic
960594162 3:119392767-119392789 CTACTCTCCTCAGCCTCACCAGG + Intronic
960635754 3:119782734-119782756 CTGCTGTCCTTGGCCTCAGGGGG - Exonic
965536910 3:169832663-169832685 CTGCTGACCTTAGGAACAGCAGG + Intronic
965597553 3:170423270-170423292 CGCCTGTACTTAGCCACACCGGG - Exonic
967627293 3:191701987-191702009 CTGCGGTCTTTACCGACACCTGG - Intergenic
968653692 4:1769811-1769833 CTGCTGTCCCAACCCGCACCTGG - Intergenic
969670502 4:8587513-8587535 CTGCTGTCCACACCCACATCCGG - Exonic
970377024 4:15469020-15469042 CTCCTGTCCTAAGTCACCCCAGG - Intergenic
972883496 4:43455671-43455693 CTGCTCTCCCTAGCCACAATGGG + Intergenic
978505726 4:109454081-109454103 CTCCTGACCTCAGGCACACCTGG + Intronic
978506241 4:109460531-109460553 CTGCTGTCCTTTGCTACAAATGG - Intronic
979748229 4:124243752-124243774 GTGGTGGCCTCAGCCACACCTGG - Intergenic
982469802 4:155774275-155774297 CTGCTGTCCTCTGACACCCCAGG + Intronic
984930571 4:184843720-184843742 CAGCTGTTCCTAGCCACACCTGG + Intergenic
985529869 5:427669-427691 CTGCTGTCCCGAGCCACTCATGG + Exonic
986547766 5:8917881-8917903 ATGCTGTCCTCTGTCACACCTGG - Intergenic
989122466 5:38018318-38018340 CTCCTTTCCTTAGCCACATGTGG - Intergenic
998797573 5:145835719-145835741 ATGCTGGCCTTTGTCACACCAGG - Intergenic
1002279334 5:178121470-178121492 CTGCTGTCTTCTGGCACACCTGG - Exonic
1004608670 6:17218093-17218115 TTGCTGTCCTTAATTACACCAGG + Intergenic
1006583015 6:35087472-35087494 CTGCTGTACTGAGCCACAGCTGG + Intronic
1007094243 6:39203569-39203591 CTCCTGGCCTCAGCCTCACCTGG - Intronic
1007375640 6:41454884-41454906 CTGATGTCCTCACCCACACCAGG + Intergenic
1007741479 6:44012516-44012538 CTGCTGTCCATAACCACTGCTGG + Intergenic
1018291016 6:162292718-162292740 CTGCCTTCCTTAGACCCACCAGG + Intronic
1018472171 6:164106719-164106741 CTCCAGACCTCAGCCACACCAGG - Intergenic
1019700292 7:2471548-2471570 CAGCTGTCCTCAGCCCCTCCCGG + Intergenic
1019915458 7:4129474-4129496 CTGCTGTCCTCACACAGACCGGG - Intronic
1020026282 7:4902337-4902359 CTCCTGCCCTTGGCCAGACCTGG - Intergenic
1020140148 7:5607419-5607441 CTGCTATCCTTAGGGGCACCTGG - Intergenic
1023175963 7:37435823-37435845 CTACCATCCTTAGCCACAGCTGG + Intronic
1024543598 7:50499427-50499449 CTGCTGGCCCCAGACACACCAGG + Intronic
1025191660 7:56900174-56900196 CTCCTGTCCTTCTGCACACCAGG + Intergenic
1025680288 7:63676760-63676782 CTCCTGTCCTTCTGCACACCAGG - Intergenic
1026305471 7:69136544-69136566 CTGCTGCCCACAACCACACCTGG - Intergenic
1026570065 7:71521547-71521569 CTGCAGTCCTTACCCACAGGAGG - Intronic
1031060422 7:117045380-117045402 CTGCTCTCCTTGGATACACCAGG + Intronic
1033607896 7:142940794-142940816 CTGCTGTCCTGAACAAAACCAGG - Exonic
1033920499 7:146386037-146386059 CTGCTGGCCTTATCCCCAACAGG + Intronic
1034383925 7:150722338-150722360 CTGCAGTCCTTAGCCTGAGCTGG - Exonic
1035322553 7:158042679-158042701 TGGCTGTCCTGAGCCACAGCCGG + Intronic
1038539984 8:28384317-28384339 GAGATGTCCTTAGCCATACCAGG - Intronic
1040611532 8:48988610-48988632 GTGCTGTCCTTACCCACATCTGG + Intergenic
1042945674 8:74152422-74152444 CAGCTTTCCTGAGCCACAGCTGG + Intergenic
1043480122 8:80644310-80644332 CTACTGTCCTCAGCCCCTCCTGG + Intronic
1047534037 8:125703055-125703077 CTGCGCTTCTGAGCCACACCTGG + Intergenic
1048335751 8:133500989-133501011 CTGCTGGGCTGAGCCACACCAGG + Intronic
1048782009 8:138012453-138012475 GTCCTGGCCTTAGCCACACTGGG + Intergenic
1049211178 8:141387120-141387142 CTGCTGGCCTCAGCCCCATCTGG - Intergenic
1049251828 8:141593355-141593377 CAGGTGCCCTCAGCCACACCTGG - Intergenic
1049893882 9:96143-96165 CTTCTGTCCTTAGACCCAGCTGG + Intergenic
1053138116 9:35664491-35664513 TTGCTGTCCTTGCCCACACAGGG - Exonic
1053735110 9:41096227-41096249 CTTCTGTCCTTAGACCCAGCTGG + Intergenic
1054693272 9:68335170-68335192 CTTCTGTCCTTAGACCCAGCTGG - Intronic
1055671973 9:78616679-78616701 CTGCCCTCTTTAGCCACACAGGG - Intergenic
1056658957 9:88530916-88530938 TTGGTGTCCTGGGCCACACCTGG - Intergenic
1057221279 9:93259204-93259226 CTGCTGGCCGTAGCCCCACCGGG + Exonic
1057502551 9:95607233-95607255 CTGCTGTTCCAAGCCAAACCCGG + Intergenic
1060139674 9:121199396-121199418 CTGTTGTCTTTAGCCATGCCTGG + Intronic
1060538716 9:124414814-124414836 CTGCTGCTCTTAGCCTAACCCGG + Intronic
1061844156 9:133377355-133377377 CTGCTGTTCTAAGCCACAGCGGG - Intronic
1061968089 9:134027259-134027281 ATGCTGTCCCTAGCAGCACCTGG - Intergenic
1191040073 X:56069224-56069246 CTGTTGTCCTGAGAAACACCTGG + Intergenic
1192446314 X:71214165-71214187 CAGCTTCCCTTAGCCAAACCTGG - Intergenic
1192624287 X:72711871-72711893 GTGTTGTCCTTAGCAACAGCAGG - Intronic
1192745355 X:73932976-73932998 GTGCTGTGCTTAGCCACATTGGG + Intergenic
1199972384 X:152870854-152870876 CTGCTGGCCTCACCCACTCCGGG - Intergenic
1200096577 X:153667402-153667424 CTGCTGTTCTGGGCCACACAGGG - Intergenic
1201377513 Y:13339281-13339303 CTGGGGTCCTTAGCACCACCAGG + Intronic