ID: 952966203

View in Genome Browser
Species Human (GRCh38)
Location 3:38622707-38622729
Sequence CCTATTAGGTGTCATGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952966203_952966213 23 Left 952966203 3:38622707-38622729 CCTGCTCCATGACACCTAATAGG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 952966213 3:38622753-38622775 GCTGGTAGGGTCTCGTGTGGAGG 0: 1
1: 0
2: 1
3: 7
4: 76
952966203_952966208 5 Left 952966203 3:38622707-38622729 CCTGCTCCATGACACCTAATAGG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 952966208 3:38622735-38622757 GAGACTTGAAACCACACTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 146
952966203_952966214 24 Left 952966203 3:38622707-38622729 CCTGCTCCATGACACCTAATAGG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 952966214 3:38622754-38622776 CTGGTAGGGTCTCGTGTGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 84
952966203_952966215 28 Left 952966203 3:38622707-38622729 CCTGCTCCATGACACCTAATAGG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 952966215 3:38622758-38622780 TAGGGTCTCGTGTGGAGGGAAGG 0: 1
1: 0
2: 1
3: 6
4: 157
952966203_952966209 9 Left 952966203 3:38622707-38622729 CCTGCTCCATGACACCTAATAGG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 952966209 3:38622739-38622761 CTTGAAACCACACTGCTGGTAGG 0: 1
1: 0
2: 3
3: 19
4: 141
952966203_952966212 20 Left 952966203 3:38622707-38622729 CCTGCTCCATGACACCTAATAGG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 952966212 3:38622750-38622772 ACTGCTGGTAGGGTCTCGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 52
952966203_952966210 10 Left 952966203 3:38622707-38622729 CCTGCTCCATGACACCTAATAGG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 952966210 3:38622740-38622762 TTGAAACCACACTGCTGGTAGGG 0: 1
1: 0
2: 0
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952966203 Original CRISPR CCTATTAGGTGTCATGGAGC AGG (reversed) Intronic
901360313 1:8692967-8692989 TCTACTATTTGTCATGGAGCAGG - Intronic
903015082 1:20356287-20356309 CCTCCTAGGTGCCCTGGAGCTGG + Intergenic
905221494 1:36450861-36450883 CCTCTTACGTAACATGGAGCTGG + Intergenic
908445783 1:64198361-64198383 CCTCCTATGTGTCATGGAGCTGG + Intergenic
909691141 1:78409328-78409350 CCTATGAGGTATCATGGAAGTGG - Intronic
911086801 1:93985534-93985556 GCTCTTAGGTGTTAGGGAGCCGG + Intergenic
912927847 1:113929529-113929551 CTCAGTAGGTGTCATGGCGCGGG + Intronic
916379178 1:164189302-164189324 CCTGTTAGTATTCATGGAGCAGG + Intergenic
916698811 1:167269067-167269089 GCTCTTTGGTGTCATGGAGATGG + Intronic
917037845 1:170768778-170768800 CCTCTTAGGTGACATGAGGCTGG - Intergenic
918134378 1:181658669-181658691 CAGATTAGATGTCATGGAACTGG + Intronic
918256272 1:182751394-182751416 CCTATTAGGTGTCAGGTACCAGG + Intergenic
1063399625 10:5730189-5730211 CTTGTTAGGTGAGATGGAGCTGG + Intronic
1067097783 10:43313923-43313945 CCTAGAAGGTGGCAGGGAGCTGG - Intergenic
1074118264 10:110473993-110474015 CCCAGTAAGTGTCATGGAGGAGG - Intergenic
1076081478 10:127585423-127585445 CCTATTATGTGGCTTGTAGCAGG - Intergenic
1084176224 11:67423755-67423777 CCTGCCAGGTGTCATGAAGCTGG + Exonic
1086988157 11:93272486-93272508 CCTATTGTGGGTCATGGAGGAGG - Intergenic
1088971380 11:114777499-114777521 CCTAGTAAGAGTCATGAAGCTGG + Intergenic
1091682553 12:2537539-2537561 GCCATTAGGTGTCATGGAACCGG + Intronic
1092061372 12:5553663-5553685 CCTAGTAGGTGGCATGGTGGTGG + Intronic
1102734107 12:115142715-115142737 CTTCTAAGGTGTCATGGATCTGG + Intergenic
1104208736 12:126666370-126666392 CCTAGTAAGTACCATGGAGCAGG + Intergenic
1104643595 12:130482322-130482344 CCTACTAGGTGCCAAGAAGCTGG + Intronic
1105927912 13:25024256-25024278 TCCATCAGGTGTCCTGGAGCTGG + Intergenic
1113777147 13:112954314-112954336 CCCAGGAGGTGTCCTGGAGCAGG - Intronic
1119267470 14:73271794-73271816 CCTATTAAGTTTCATTCAGCTGG - Intronic
1122769293 14:104090765-104090787 GATATTAGGGGTCATGGGGCGGG - Intronic
1124692726 15:31839048-31839070 CCTATGGAGTGCCATGGAGCAGG - Intronic
1124918388 15:33999000-33999022 TCTAATAGGCGACATGGAGCAGG - Intronic
1126225382 15:46263017-46263039 CCTATGAGGTGCCATGGAAGTGG + Intergenic
1127798738 15:62459699-62459721 CTTAGTAGGTGTCCTGGGGCAGG + Intronic
1129730979 15:77932701-77932723 CCTCTTTGGTGTCTTGGTGCTGG - Intergenic
1129829254 15:78657369-78657391 CCTATTAGGTGTTGTGCAGCTGG - Intronic
1133652177 16:7822761-7822783 TCTATAAAGTGTCATGGCGCTGG - Intergenic
1134126812 16:11621717-11621739 ACTACAAGGTGTCAGGGAGCCGG - Intronic
1138392825 16:56682780-56682802 CCAACTGGGTGACATGGAGCAGG - Intronic
1142114299 16:88348397-88348419 CTTTTCTGGTGTCATGGAGCTGG - Intergenic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1149665602 17:58362975-58362997 CCAATCAGGGGTCATGGATCAGG + Intronic
1150995378 17:70311255-70311277 ACTCTAAGGTCTCATGGAGCGGG - Intergenic
1151472743 17:74328012-74328034 CCTGGTAGGTGGGATGGAGCAGG - Intronic
1156721945 18:40080935-40080957 CCTATTGGGCGTCAAGGACCAGG - Intergenic
1157070022 18:44395576-44395598 CCTATTAATTGTCATGAAGAAGG + Intergenic
1158984454 18:62800115-62800137 CCTATTAGGTGGCCTCCAGCTGG - Intronic
1159820960 18:73143028-73143050 CCTATTTGGTCTCCTGGGGCTGG - Intergenic
1161199097 19:3004661-3004683 CCTCTTAGGTTTCAAGGAGGAGG + Intronic
1164927968 19:32145438-32145460 TGTATTAGGGGTCAGGGAGCTGG - Intergenic
926044284 2:9698403-9698425 CCTCTGTGCTGTCATGGAGCAGG + Intergenic
936064579 2:109320634-109320656 CATATTGGGTGTTATAGAGCTGG - Intronic
936087997 2:109482574-109482596 CCTCTTAGGGGTCATGGCCCCGG - Intronic
941491642 2:166149477-166149499 CCTTTTAGGTGTCATGGTACAGG - Intergenic
944538529 2:200735056-200735078 TCTCTGAGGTGTCCTGGAGCAGG + Intergenic
946353830 2:219172618-219172640 CCTTTTCAGTGTCATGGAGCTGG - Exonic
946408662 2:219505867-219505889 CCTATTGTGTGTCCTCGAGCAGG + Intronic
946519647 2:220450935-220450957 CCTATGAGGAGTTCTGGAGCTGG - Intergenic
1179676530 21:42986707-42986729 CCTAAAAGGTGTCCTGGAGAAGG + Intronic
1183993111 22:41612106-41612128 CCTAGTAAGTGTCATGAAGGAGG - Intronic
1185069268 22:48647365-48647387 GCTATGAGGTGACATGGGGCGGG + Intronic
949474815 3:4433335-4433357 CAGATCAGGTGTCTTGGAGCAGG + Intronic
952548671 3:34450569-34450591 CCTATGAGGTGCCATGGAAGTGG + Intergenic
952966203 3:38622707-38622729 CCTATTAGGTGTCATGGAGCAGG - Intronic
955328305 3:58026438-58026460 CCAACTTGGTGTCATGGAGCTGG + Intronic
955524641 3:59807845-59807867 CTTGTTTGGTTTCATGGAGCAGG + Intronic
959162023 3:102735493-102735515 AATATTAGGTGCCATGGAGAAGG + Intergenic
959916449 3:111821738-111821760 CAAATTAGCTGTCATGGAGCTGG - Intronic
960816325 3:121676937-121676959 CCTTTAAGCTGTCATTGAGCTGG + Exonic
961331428 3:126143377-126143399 CGTATCAGGTGGGATGGAGCGGG + Intronic
963569643 3:146976956-146976978 CCTATTAGGAGTGTTGGAGTGGG - Intergenic
963637466 3:147816866-147816888 CCTCATAGCTGTAATGGAGCTGG + Intergenic
967567970 3:190993478-190993500 CCTCTTGGGTGTCAAGGAGAAGG + Intergenic
971105837 4:23523892-23523914 CCTGTGAGGTGTCATGGAAGTGG - Intergenic
971918735 4:32909705-32909727 CCCATGAGGTGTCATGGAAATGG - Intergenic
982833914 4:160098597-160098619 TTTATTAAGTGTCATGTAGCAGG - Intergenic
987192050 5:15488452-15488474 TTTAAGAGGTGTCATGGAGCAGG + Intergenic
988678652 5:33461043-33461065 CATATTCTGTGCCATGGAGCAGG + Exonic
993458045 5:88147254-88147276 ACTATTAGGAGTGATGGATCAGG - Intergenic
994770568 5:103975778-103975800 ACTATCATGTGTCATGGAGAAGG - Intergenic
996901813 5:128551593-128551615 CCTGTGAGGTGTCATGGAAGTGG - Intronic
1000855047 5:166387774-166387796 CCTATTTGGTGTCAAGAAGATGG + Intergenic
1002108361 5:176891466-176891488 CCTCTTGGGTTCCATGGAGCAGG - Exonic
1002433835 5:179219692-179219714 CCTCTGAGGTGTCCTGCAGCAGG + Intronic
1008649330 6:53547343-53547365 CCTGTTAGGAATCATGGACCTGG + Intronic
1009528767 6:64782368-64782390 CCTATTTAGGGTCATGAAGCAGG + Intronic
1045459218 8:102412165-102412187 CCTATTACCTGTCATTGAGCTGG + Exonic
1046847479 8:118934232-118934254 CCTACTAGGTGTCAAGCACCAGG + Intronic
1058461831 9:105190335-105190357 CCTGTGAGGTGTCATGGAAGTGG + Intergenic
1060279928 9:122208957-122208979 ACTGTGAGGTGTCTTGGAGCTGG + Intronic
1061471017 9:130825974-130825996 CCTAGTAGGTGTCATGTCACAGG + Intronic
1188693477 X:33158657-33158679 CCTATTGCCTGTTATGGAGCAGG + Intronic
1190441075 X:50474901-50474923 CCTATTAGGTGTCCTGGGGAAGG + Intergenic
1198581724 X:138073126-138073148 CCTAATAGCTGCCATGGATCTGG - Intergenic
1199853726 X:151743085-151743107 TCTACTAGGTTTCCTGGAGCAGG + Exonic
1200325291 X:155231495-155231517 CTTATTATGTGTCAGGGAACTGG - Intronic