ID: 952967563

View in Genome Browser
Species Human (GRCh38)
Location 3:38630713-38630735
Sequence GCCTCTGCTGTGACAACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952967563_952967564 -10 Left 952967563 3:38630713-38630735 CCAGCTGTTGTCACAGCAGAGGC 0: 1
1: 0
2: 1
3: 14
4: 216
Right 952967564 3:38630726-38630748 CAGCAGAGGCTCAGCAGACCTGG 0: 1
1: 0
2: 3
3: 33
4: 355
952967563_952967565 -9 Left 952967563 3:38630713-38630735 CCAGCTGTTGTCACAGCAGAGGC 0: 1
1: 0
2: 1
3: 14
4: 216
Right 952967565 3:38630727-38630749 AGCAGAGGCTCAGCAGACCTGGG 0: 1
1: 0
2: 1
3: 40
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952967563 Original CRISPR GCCTCTGCTGTGACAACAGC TGG (reversed) Intronic
900878912 1:5366477-5366499 CCCTTTGCTGTGACCACAGCAGG + Intergenic
903141879 1:21344198-21344220 GCCCCTGCTGTGCCCAGAGCTGG - Intronic
903752678 1:25636813-25636835 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
904302226 1:29561684-29561706 GCCCTTGGGGTGACAACAGCAGG + Intergenic
904804642 1:33122186-33122208 GCATCTGCTGTGAAAAGCGCAGG + Intergenic
905817739 1:40965150-40965172 GCCTGTCCTGTGGGAACAGCAGG + Intergenic
906389962 1:45406538-45406560 GCCTCAGCCTTCACAACAGCTGG - Intronic
906962425 1:50426695-50426717 GCCTCTGCTGTGCCAGGGGCTGG + Intergenic
907871621 1:58448839-58448861 GCCTTGGCTGTGAGTACAGCAGG + Intronic
911084244 1:93963328-93963350 GCCACTGCTGGGACACCATCAGG - Intergenic
911656637 1:100451246-100451268 ACCTCTGCTGGTACAACAGCAGG - Intronic
913525047 1:119683236-119683258 GCCTATGCTATGAGAACAGAAGG + Intronic
916653356 1:166850656-166850678 GCCGCTGCTGTGACAGCGGGCGG - Exonic
918182937 1:182100849-182100871 GCCTGTGCTGTGCCAGCTGCAGG - Intergenic
920256532 1:204659045-204659067 GCCAGTGCTGTGAGACCAGCAGG + Intronic
921533085 1:216309380-216309402 GCCTCTGCTCAGACAATAGGTGG + Intronic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
922532664 1:226356367-226356389 CCATCTGCTGAGACAGCAGCTGG + Intergenic
923892954 1:238235867-238235889 GACTCCCATGTGACAACAGCAGG + Intergenic
923898505 1:238299969-238299991 GCCTCTGCTTTGACTCCAACAGG + Intergenic
1064523033 10:16223524-16223546 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1065966446 10:30774790-30774812 GACTCTGCTGGGACATCAGATGG + Intergenic
1067451408 10:46384279-46384301 GCCTAGGCTGTGACACCTGCAGG - Intronic
1067585834 10:47475477-47475499 GCCTAGGCTGTGACACCTGCAGG + Exonic
1068705984 10:60075989-60076011 ACCTCTCCAGTGACTACAGCAGG - Exonic
1069570085 10:69489526-69489548 TCCTCTGCTGTGGCTGCAGCTGG + Intronic
1069893164 10:71664497-71664519 GCCTGTCCTGTGCCAGCAGCGGG - Intronic
1073069753 10:100785839-100785861 GCCTCTGGAGTGAGCACAGCAGG + Intronic
1074832924 10:117262497-117262519 GCCTCTCCAGTGTCAGCAGCGGG - Intronic
1075013262 10:118892621-118892643 GACTCTGCTGTGACAGCAAAGGG + Intergenic
1076219744 10:128723621-128723643 AACTCTGCTGTGAGAACAACAGG - Intergenic
1076617441 10:131765272-131765294 GCCTGTGATGGGACAGCAGCTGG + Intergenic
1076625529 10:131819387-131819409 GCCCCTGCTGTGACACCACACGG - Intergenic
1076661229 10:132057188-132057210 GCCACTACTGTGGCAACATCTGG + Intergenic
1077213595 11:1384751-1384773 GACTCAGCCGTGACCACAGCGGG - Intergenic
1077433746 11:2528411-2528433 GCTGCTGCTGGGACACCAGCAGG - Intronic
1077553477 11:3214641-3214663 GACTCTGCTGTGAGAAAACCTGG + Intergenic
1079384361 11:19965853-19965875 GCCTCTGCTTGGAAAACAGCAGG + Intronic
1080121351 11:28681429-28681451 GCCACTGCTGTGAAAACATGGGG + Intergenic
1081695327 11:45105586-45105608 GGCTCTGCTGTCACCACGGCTGG - Intronic
1083235730 11:61349625-61349647 GCCTCAGCTGTAGCAGCAGCTGG + Exonic
1084225937 11:67714880-67714902 GCCTCTGCCCTGCCAGCAGCAGG + Intergenic
1084809643 11:71604366-71604388 GCCTCTGCCCTGCCAGCAGCAGG - Intergenic
1087681350 11:101221326-101221348 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
1090137332 11:124210868-124210890 GCCTCTCCTGCCACAACCGCTGG + Intergenic
1091433671 12:457350-457372 TCCCCTGCTGTGACATCACCAGG + Intergenic
1092594434 12:9986002-9986024 TCCTCTTCTGTGACAGTAGCTGG + Intronic
1094750168 12:33397310-33397332 GCCTCTGCTGTTACCACTCCAGG - Intronic
1095953094 12:47791946-47791968 GCTCCTGCGGTGACAACAGCAGG - Exonic
1096092783 12:48914478-48914500 GCCTCTGCAGGGCCAAGAGCTGG - Exonic
1097021982 12:56027098-56027120 GGCAGTGCTGGGACAACAGCAGG + Intronic
1100087571 12:90930305-90930327 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
1100970521 12:100065073-100065095 TCCTCTGCTGTGGCTCCAGCTGG - Intronic
1102222634 12:111204819-111204841 CCCAGTGCTGTGAGAACAGCAGG - Intronic
1103358906 12:120342310-120342332 GCCTCAGCTGTGGCCACGGCAGG - Exonic
1103994658 12:124821319-124821341 GCCTCTGCTGAGAAACCAGGTGG - Intronic
1104421299 12:128637792-128637814 GCTTCTGCTGTGCCAACTGTGGG - Intronic
1105418101 13:20230925-20230947 GCCACTGCAGTGACTAAAGCTGG - Intronic
1105897809 13:24732203-24732225 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
1107103796 13:36622494-36622516 GCCTCTGCTGTAGCTACTGCAGG - Intergenic
1110953621 13:81524628-81524650 TCCTCTGCTGTGGCTCCAGCTGG - Intergenic
1113149304 13:107243799-107243821 GCCTCTGCTGTGGCTACAGGAGG + Intronic
1113917826 13:113884583-113884605 GCCTCTGCTGTTTCAGCAGGAGG + Intergenic
1113956570 13:114102673-114102695 GCCTTGGCTGTGACACCACCTGG - Intronic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1117636765 14:57752872-57752894 GCTTCTGCTGTAGCAACAGCAGG - Intronic
1117784201 14:59265703-59265725 GCCTCTGCTGTTGCAACCACTGG - Intronic
1118216403 14:63812704-63812726 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1119375725 14:74190969-74190991 GCCTCTGATATGAGAGCAGCTGG - Intronic
1122846753 14:104504410-104504432 GCCTGTGCTGTGCCAGCTGCCGG - Intronic
1122871633 14:104641403-104641425 CCCACAGCTGTGACCACAGCTGG + Intergenic
1124200494 15:27674841-27674863 GGCTCTGCTGTGCCCACAGAGGG - Intergenic
1124568493 15:30837963-30837985 CCCTCTGCTGTGACAGCTGATGG + Intergenic
1126805132 15:52340360-52340382 TCCTCTTCTGTGACTGCAGCTGG + Exonic
1127386714 15:58473084-58473106 GCCTCTGCAGTCCCAGCAGCTGG + Intronic
1128867595 15:71126246-71126268 GCCTGTGCTGGTACCACAGCAGG - Intronic
1129827620 15:78644964-78644986 GCCTCAGCTGTCAAAACATCAGG - Intronic
1130213909 15:81950961-81950983 GCCTCTGCTGTTACACAGGCAGG - Intergenic
1131573429 15:93562508-93562530 GCCTCTGGTGCAGCAACAGCTGG + Intergenic
1131748752 15:95481775-95481797 ACTTCTGCTGTGACATCAGCTGG + Intergenic
1131988102 15:98065419-98065441 GCCTCTGCCTTCCCAACAGCGGG + Intergenic
1132747131 16:1441502-1441524 GCCCCTGCTGAGGCCACAGCAGG + Intronic
1132898241 16:2238897-2238919 GCCTGTACTGTGAGCACAGCTGG + Intergenic
1133678270 16:8096368-8096390 GCTTCAGCTGTGACCAGAGCTGG - Intergenic
1138011402 16:53384200-53384222 TCTTCTGCTGTGACTTCAGCTGG - Intergenic
1138531013 16:57634383-57634405 TCCTCTGCTGTGTCACCATCTGG + Intronic
1138578511 16:57924100-57924122 GCCTCTGGCCTGACATCAGCAGG + Intronic
1138586261 16:57972263-57972285 GACTCAGCTGTGAAAAAAGCTGG + Intergenic
1139529241 16:67534599-67534621 GCCTCTTCAGTCACAACACCTGG + Intronic
1139740969 16:69034507-69034529 GCTTATGCTGTAACCACAGCTGG - Intronic
1139796978 16:69491072-69491094 CCCTCAGCTGTGGCATCAGCAGG + Intergenic
1140155940 16:72426736-72426758 GCCTCTGCTGGGAGAAGAGAGGG + Intergenic
1141072988 16:80975046-80975068 GCCCCTGCTGTGACTGCAGCTGG + Exonic
1141141205 16:81497903-81497925 GCCTCTGGGGGGACCACAGCTGG - Intronic
1141688799 16:85585140-85585162 GCCTCGCCAGAGACAACAGCAGG - Intergenic
1141695368 16:85616532-85616554 GTCTCTGTTGTGGCAACAGCAGG + Intronic
1141812923 16:86388170-86388192 CCCACTGCAGTGACCACAGCCGG + Intergenic
1143268611 17:5659109-5659131 GCCCCTGCTGTGAAAAGAGGAGG - Intergenic
1144673699 17:17147405-17147427 GCCTCTGCTGTGGAGACAGCTGG + Intronic
1148809885 17:50283655-50283677 GGCTCTGCAGAGACAACTGCAGG - Intergenic
1149466955 17:56887669-56887691 GCCTCTGTTCTGACACCACCTGG + Intergenic
1152975878 18:217868-217890 CCCTCTGCTTTAACCACAGCAGG - Intronic
1154010169 18:10567545-10567567 GGCCCTGCTGTGACATAAGCAGG + Intergenic
1154444584 18:14424695-14424717 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1157471364 18:47991514-47991536 GCCTCTGCTGTGAGGAAATCTGG + Intergenic
1158629084 18:59096388-59096410 GCCTGTGCTGGGAAAACAGAAGG - Intergenic
1159513755 18:69431039-69431061 GCCTCCACTGTGACAAAATCAGG + Intronic
1160240363 18:77118377-77118399 GCCTGTCCTGTGCCAACTGCTGG - Intronic
1160540092 18:79616672-79616694 GCCTCGGCTGTGTCAACAGATGG - Intergenic
1163572546 19:18090946-18090968 GCCTCTGCTGTGGCCTCTGCCGG - Intronic
1163941699 19:20501173-20501195 TCCTCTGCTGCGACTCCAGCTGG + Intergenic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1165059418 19:33197801-33197823 GCCTCCCCTTTGACCACAGCAGG - Intronic
1165271677 19:34713053-34713075 GCCCATACTGTGCCAACAGCAGG + Intergenic
1165642136 19:37398668-37398690 GCCTCTGCTGTGGCTCAAGCTGG - Intergenic
1165790065 19:38486014-38486036 GCCTCTGCTGCCCCAGCAGCTGG - Exonic
927313775 2:21658563-21658585 GCATCTGCTTTGAAGACAGCAGG + Intergenic
927884458 2:26710058-26710080 TCCTCTGCTGTGTCCTCAGCTGG + Intronic
932395518 2:71444468-71444490 TCCTCTGCTGTGGCTCCAGCTGG - Intergenic
932656807 2:73617688-73617710 GCTCCTGCTATGGCAACAGCAGG - Intergenic
936149654 2:110008263-110008285 GTGTCTGCTGTGAAGACAGCAGG + Intergenic
936195024 2:110363106-110363128 GTGTCTGCTGTGAAGACAGCAGG - Intergenic
936867535 2:117092328-117092350 GCCTCTGCTGTGTTAAAAACAGG - Intergenic
938079227 2:128360464-128360486 GCCTCAGCTGTCTCACCAGCTGG + Intergenic
938307333 2:130264882-130264904 CCCTCTGCTGTGGCCACAGATGG + Intergenic
938447998 2:131391962-131391984 CCCTCTGCTGTGGCCACAGACGG - Intergenic
947254742 2:228149583-228149605 TCCTCTTCTGTGACTACAGATGG - Intronic
948717762 2:239876249-239876271 ACCTCTGCTGTGATAGCAACTGG + Intergenic
948852901 2:240717179-240717201 GCCTCTGCTGGGAGCACAGCTGG + Exonic
1168918247 20:1509402-1509424 AGCTCTGCAGTGACACCAGCAGG - Intergenic
1170771290 20:19334940-19334962 GCCTCTGCTGTGCCATATGCAGG + Intronic
1171003029 20:21433893-21433915 GCCTCTCCTCTGACCCCAGCTGG - Intergenic
1171480936 20:25455154-25455176 GCCTCTGCTGGGGACACAGCTGG + Intronic
1172042217 20:32053271-32053293 GCCTCTGTTTTCACAACTGCAGG + Intronic
1173671776 20:44803962-44803984 GCTTGTGCTGTCAGAACAGCAGG - Intronic
1174486320 20:50863668-50863690 GACTCTGATGTGACAGCAGTTGG + Intronic
1175790633 20:61738026-61738048 GGCTCTGGTGTGAGGACAGCAGG + Intronic
1176032141 20:63017764-63017786 CCCGCTGCTGGGACCACAGCAGG + Intergenic
1176172055 20:63700524-63700546 CCCTTTGCTGTGAAGACAGCGGG + Exonic
1176905296 21:14493165-14493187 GGGGCTGCTGTGACCACAGCTGG + Intronic
1177386811 21:20419640-20419662 GCCTCAGATGAGCCAACAGCTGG + Intergenic
1179164592 21:38925648-38925670 TCCTCTGCTGGGAATACAGCAGG - Intergenic
1179292620 21:40031879-40031901 GTCTCTACTGTGAGAGCAGCAGG - Intronic
1180583100 22:16860102-16860124 GTGTCTGCTGTGAAGACAGCAGG - Intergenic
1180721299 22:17910766-17910788 TCCTTGGCTCTGACAACAGCCGG + Intronic
1181130177 22:20726618-20726640 GCTTCTGCTCTGCCCACAGCAGG + Intronic
1183541045 22:38429635-38429657 GCCTCTTCTGCTGCAACAGCTGG - Intronic
1183839369 22:40485395-40485417 GCCTGAACTGTGGCAACAGCTGG + Intronic
1184754624 22:46508885-46508907 GCCTTGGCGGAGACAACAGCAGG - Intronic
1184943075 22:47782890-47782912 GCCTCTTCTTTGAGACCAGCAGG + Intergenic
950380973 3:12614550-12614572 GCCTCGGCTGGGACCACAGGTGG + Intronic
950658497 3:14452141-14452163 GCCTCCTCTGTGAAAACAGAGGG - Intronic
950700450 3:14741937-14741959 ACCACTGCTGTGGCAACACCTGG - Intronic
950853781 3:16086889-16086911 CCCTCTGTTGTGGCAACAGCAGG + Intergenic
952967563 3:38630713-38630735 GCCTCTGCTGTGACAACAGCTGG - Intronic
953846519 3:46431576-46431598 TCCTCTGCTGTGGCTCCAGCTGG - Intergenic
958424336 3:93963947-93963969 TCCTCTGCTGTGGCTCCAGCCGG - Intronic
958497504 3:94864019-94864041 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
960932002 3:122861670-122861692 GCCTCTGATGTGTAAACTGCTGG - Intronic
961823468 3:129586897-129586919 GCCTCTGCTGTGCCCCCACCAGG + Intronic
962275314 3:134008891-134008913 GACTCAACTGTGACAACAGATGG + Intronic
962580165 3:136790936-136790958 GCCTCTGCTTTGATTAAAGCAGG + Intergenic
963454148 3:145522391-145522413 GCCTGCCCTGTGGCAACAGCTGG - Intergenic
964716565 3:159728631-159728653 TGCTCTGCTGTGACCACTGCAGG - Intronic
966517127 3:180830188-180830210 GCCTCTGCTGCTGCAGCAGCAGG + Intronic
966822861 3:183938797-183938819 GCTGCTGCTGTGGCAACAGGAGG - Intronic
970810397 4:20086752-20086774 ACCGCTGCTGCGAGAACAGCAGG - Intergenic
970894251 4:21084071-21084093 GCTTCTGCTGTGGCTCCAGCAGG + Intronic
973659159 4:53084633-53084655 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
979974377 4:127178424-127178446 CCCTCTGCTGTGATTATAGCAGG - Intergenic
983303471 4:165956831-165956853 TCCTCTGCTGTGGCTCCAGCCGG + Intronic
985362441 4:189190026-189190048 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
987242794 5:16017805-16017827 GCCTCTTCTGTGGCAAATGCTGG + Intergenic
988553872 5:32220140-32220162 GCCTCAGCTGGGACTACAGGCGG + Intergenic
990471980 5:56123908-56123930 GCCTCAGCTGTCACAGCAGGGGG + Intronic
991264045 5:64696039-64696061 TCCTCTGCTGTGGCTCCAGCCGG - Intronic
991349238 5:65703601-65703623 GCCTCTGCTGGGACATCAGGTGG - Intronic
992768031 5:80020637-80020659 TCCTCTGGTGTGATAGCAGCAGG + Intronic
992868646 5:80983263-80983285 ATCTCTGCTGTGGCAACTGCAGG + Intronic
993048217 5:82893210-82893232 GCCTCGTCTGTGTCTACAGCAGG - Intergenic
995187466 5:109287269-109287291 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
996404659 5:123093821-123093843 GGCTGTGCTGAGAGAACAGCCGG - Intronic
999309537 5:150543028-150543050 GAGTCTGCTGTGGCCACAGCAGG + Intronic
999947723 5:156615180-156615202 GCATCTTCAGTGACAACACCAGG + Intronic
1002422449 5:179155680-179155702 CCCTCTGCTGAGACAGGAGCTGG - Intronic
1003549119 6:7086072-7086094 GCCTCTGCTCTGTCATCAGGAGG - Intergenic
1005527789 6:26668444-26668466 GCCAATGCAGTGAGAACAGCAGG + Intergenic
1005543005 6:26833228-26833250 GCCAATGCAGTGAGAACAGCAGG - Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1006410799 6:33872246-33872268 TCCTCTCTTGTGACAAGAGCAGG + Intergenic
1009013822 6:57875409-57875431 GCCAATGCAGTGAGAACAGCAGG - Intergenic
1010776455 6:79891721-79891743 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1010816663 6:80365833-80365855 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
1013226841 6:108125303-108125325 GCCTCTGCTGTGCCCGCAGTTGG + Intronic
1013565998 6:111363122-111363144 GCCTGTGCTGTGAAGATAGCTGG + Intronic
1014059165 6:117050846-117050868 GCCTCAGCTGTGACATCAATAGG + Intergenic
1015459968 6:133478823-133478845 CCCTTTGCTGTGACAGCTGCTGG + Intronic
1017517684 6:155172016-155172038 GCATCTGCTGTGAGAACACACGG + Intronic
1018102209 6:160450759-160450781 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
1020309710 7:6858703-6858725 GCCTCTGCCCTGCCAGCAGCAGG + Intergenic
1021090127 7:16473320-16473342 GCCTCTGATGTGACACGAGGAGG - Intronic
1021176858 7:17459536-17459558 ACCTCTGCTGTGGCTCCAGCCGG + Intergenic
1032499072 7:132386279-132386301 GCCTCTGCAGGGAGAACACCGGG + Intronic
1034733119 7:153405122-153405144 GCCTCAGCTGTCACGACAGAGGG + Intergenic
1034974345 7:155439193-155439215 GCCTGTCCTGTGGCCACAGCTGG - Intergenic
1035478228 7:159158847-159158869 GCCTCAGCTGTGCCAGCACCCGG - Intergenic
1035982726 8:4391490-4391512 CCCTCTGCTGTGACCAGTGCAGG + Intronic
1036396920 8:8377750-8377772 GCCTTTGCTGGGACCACATCTGG - Exonic
1037710313 8:21350351-21350373 GACTCAGCTGTGAGTACAGCAGG + Intergenic
1040926351 8:52687947-52687969 TCCTCTGCTGTGGCTCCAGCTGG - Intronic
1041244852 8:55880162-55880184 GCCGCGGCTGTGCCACCAGCCGG + Intronic
1042143939 8:65707886-65707908 GCCTCTGCTATGAGGGCAGCAGG - Exonic
1042191440 8:66191632-66191654 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1046407297 8:113790949-113790971 GACTCTTCTCTGACGACAGCTGG - Intergenic
1047172153 8:122504121-122504143 GACTCTGCTCTGAAAACAGAGGG + Intergenic
1048295914 8:133213087-133213109 GCCTCTACTGTGACTACAGCGGG + Exonic
1049214382 8:141401081-141401103 GCCTCTTCTGGGCCAGCAGCCGG + Intronic
1049243005 8:141548279-141548301 GCCTTTGCAGTGACATTAGCCGG + Intergenic
1049579057 8:143402737-143402759 CCCGCGGCTGTGACCACAGCTGG - Intergenic
1050003129 9:1099556-1099578 GCCTCTTCTGTGACTTCTGCTGG + Intergenic
1057880044 9:98786404-98786426 GCCTCTGCTTCCAGAACAGCTGG + Intronic
1060520783 9:124292772-124292794 GCCTCTCCTCTGCCAACTGCTGG + Intronic
1060850366 9:126869680-126869702 GCCTCTGCCGTGACCACACAAGG - Intronic
1062547772 9:137071293-137071315 GCCTCTGCTGTGTTTCCAGCTGG + Intergenic
1062604410 9:137338988-137339010 GGCTCTGCTGTGTCTGCAGCTGG - Intronic
1062623900 9:137434475-137434497 CCATCTGCTCAGACAACAGCAGG + Exonic
1190299624 X:49049392-49049414 GCTGCTGCTGTGACAGAAGCTGG + Intergenic
1194800718 X:98269115-98269137 TCCTCTGCCATGACCACAGCTGG - Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1198576384 X:138014476-138014498 GGCTCTGGTGTGACCACAGGAGG - Intergenic
1200725277 Y:6662640-6662662 TCCTCTGCTGTGGCTCCAGCCGG - Intergenic
1200906895 Y:8492863-8492885 GCCTGGGCTGTTACAACAGGAGG + Intergenic