ID: 952969585

View in Genome Browser
Species Human (GRCh38)
Location 3:38642321-38642343
Sequence ACCTCGGAGGCCCACCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952969579_952969585 5 Left 952969579 3:38642293-38642315 CCTACTGTGTGCACCAAGAGAGA 0: 1
1: 0
2: 0
3: 14
4: 152
Right 952969585 3:38642321-38642343 ACCTCGGAGGCCCACCTCTAGGG 0: 1
1: 0
2: 0
3: 3
4: 78
952969582_952969585 -8 Left 952969582 3:38642306-38642328 CCAAGAGAGATGGAAACCTCGGA 0: 1
1: 0
2: 1
3: 12
4: 147
Right 952969585 3:38642321-38642343 ACCTCGGAGGCCCACCTCTAGGG 0: 1
1: 0
2: 0
3: 3
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952969585 Original CRISPR ACCTCGGAGGCCCACCTCTA GGG Intronic
901931085 1:12596325-12596347 ACCCCGGAGGCCCAGCCCTCGGG - Intronic
904914363 1:33959433-33959455 AACACGCAGGCCCACCTCTGAGG - Intronic
908725733 1:67175062-67175084 ACCTCAGAGGCACACTTCTGTGG + Intronic
912711599 1:111953932-111953954 CCCTGGGAAGCCGACCTCTATGG + Intronic
922560326 1:226564998-226565020 CCCGAGGAGGCCGACCTCTACGG + Intronic
1063341920 10:5274001-5274023 CCATCTGAAGCCCACCTCTAAGG - Intergenic
1070741185 10:78904283-78904305 AGCTCTCAGGCCCACCTCTGAGG + Intergenic
1072964280 10:99957407-99957429 ATCTTGGAGACCCACCTGTAGGG - Intronic
1077404717 11:2377832-2377854 TGCTCGGGGGCCCACCTCTGCGG + Intronic
1081671724 11:44946240-44946262 TCATCGGAGGCCCACAGCTAAGG + Intronic
1082283722 11:50298536-50298558 TCGCCGAAGGCCCACCTCTATGG - Intergenic
1089636537 11:119817367-119817389 ATATCGGAGGCCCATCTCCACGG - Intergenic
1092181504 12:6450068-6450090 CCATCCCAGGCCCACCTCTAGGG - Intronic
1101675665 12:106914194-106914216 ACCTCAAAGGCCCTCTTCTAGGG - Intergenic
1112447047 13:99473589-99473611 ACCTCAGATGCACACCCCTAAGG - Intergenic
1114781530 14:25543494-25543516 TTCTCAGAGGCACACCTCTATGG + Intergenic
1121011075 14:90520662-90520684 ACCTTGGAGGCCCAGCTACAGGG + Intergenic
1122875089 14:104660242-104660264 ACCTCGGAGGCACAGCTGCAGGG + Intergenic
1136484469 16:30562351-30562373 TCCTCGAAGGGCCTCCTCTAAGG - Intergenic
1137018596 16:35399878-35399900 AACTCTAAGGGCCACCTCTAAGG - Intergenic
1140782902 16:78312840-78312862 ACCTCGGAGGCTGACCACTTAGG - Intronic
1144862533 17:18314683-18314705 GCCTCGGAGGGCCATCTCCATGG + Exonic
1146991337 17:37275621-37275643 CCCTGGGAAGCCCACCTCTGAGG + Intronic
1151673000 17:75582629-75582651 ACCACGGAGGCACACACCTAGGG - Intergenic
1154077235 18:11215392-11215414 TCCTCGAAGGCCCATCTCTCAGG - Intergenic
1156559621 18:38107850-38107872 ACCTGTGAGGCTCACCTCTATGG - Intergenic
1160967798 19:1754197-1754219 GCCTCCGTGGGCCACCTCTACGG + Exonic
1164443623 19:28298995-28299017 ATCTGGGAGGCCATCCTCTATGG - Intergenic
1165375643 19:35439819-35439841 ACCACAGAGGCCCACCACCAAGG + Intergenic
927181202 2:20447751-20447773 ACCTCGGGGACCCACTTCTCGGG - Exonic
928440304 2:31286596-31286618 TGCTCAGAGGCCCACCTCTGAGG - Intergenic
932321254 2:70823509-70823531 ACCTCGAAGGCAGAACTCTACGG + Intergenic
938911889 2:135893126-135893148 TCCTGGGAGGCCAACCTCTATGG - Intergenic
939821848 2:146967255-146967277 AGCTCTGAGACCCACCTCCATGG - Intergenic
945088998 2:206160952-206160974 ACCTGGGGGGCCCACCTCTGGGG + Intronic
946999662 2:225439499-225439521 ACTTCAGGGACCCACCTCTATGG - Intronic
1175023143 20:55872788-55872810 CCCTAGGAGACCCACCTTTATGG + Intergenic
1177002283 21:15629113-15629135 ACTTCGGTGGGCCACCTATAGGG - Intergenic
1180154955 21:45973222-45973244 GCCTCCGGGGCCCAGCTCTAGGG + Intergenic
1180990717 22:19934101-19934123 ACCTCAGGGGCCCTCCTGTATGG + Intronic
1181778227 22:25175154-25175176 CCCTGGGAGCCCCACCTCCAGGG + Intronic
1183463692 22:37968375-37968397 TCCTCTGTGGCCCACCTCTTTGG + Exonic
1183983291 22:41555216-41555238 GCCTCAGAGGCCCTCCTATAGGG + Intergenic
952969585 3:38642321-38642343 ACCTCGGAGGCCCACCTCTAGGG + Intronic
954992727 3:54855105-54855127 CCCTAGGATGCCCACCTGTATGG + Intronic
961347531 3:126273939-126273961 TCCTAGGAGGGTCACCTCTAGGG + Intergenic
961670344 3:128524083-128524105 CCCTAGGAGGCCCACCTCAGAGG + Intergenic
962932436 3:140050727-140050749 CCCTGGGAGGCTGACCTCTATGG - Intronic
968474088 4:795012-795034 TTCTGGAAGGCCCACCTCTAAGG + Intronic
971288419 4:25312604-25312626 ACCTGCGAGCCCCACCGCTAGGG + Intergenic
972687414 4:41363991-41364013 ACCTAGGATGCCCAGCTCCAAGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
978490133 4:109303038-109303060 ATCTCCGAGGGCCACCTCTCTGG + Intergenic
978497611 4:109376906-109376928 AACTCGGATGACCACCTCTTGGG - Intergenic
979335200 4:119454635-119454657 TCGCCAGAGGCCCACCTCTATGG + Intergenic
981698949 4:147586806-147586828 CCCTTGGAGGCCCAGCTCAAGGG + Intergenic
988650404 5:33142635-33142657 AGCTCGGAGGCTCTCCTCAAAGG + Intergenic
990167046 5:53005858-53005880 ACCTCAGAGGCCAAGCTCTTAGG + Intronic
990325123 5:54667622-54667644 AGCTTGGAGGCCCATCTCCAAGG + Intergenic
995355703 5:111235837-111235859 TCCTCGGGGAGCCACCTCTAAGG + Intronic
1000858618 5:166430432-166430454 ACCTCAGAGGTCCACCTCACTGG + Intergenic
1004757708 6:18631043-18631065 ACTTGGGAGGCTGACCTCTATGG - Intergenic
1005417036 6:25610914-25610936 ATCTCTGAGCCCCACCTATAAGG + Intronic
1014147474 6:118014846-118014868 TCCTCTGAGGCTCACCTATATGG + Intronic
1022097369 7:27149134-27149156 ATCTCGAAGGCACACCTCTCAGG - Intronic
1023087707 7:36588434-36588456 ACTTCAGAGGACCACCTCTCTGG + Intronic
1023881286 7:44323076-44323098 AGCTCCCTGGCCCACCTCTATGG + Intronic
1029144578 7:98436677-98436699 ACCACAAAGGACCACCTCTAAGG - Intergenic
1032011921 7:128352450-128352472 GCCTGGGAGGCCCACGTGTACGG - Exonic
1034436711 7:151066071-151066093 ACCTCTGAGTCCCATGTCTAGGG + Intronic
1045002191 8:97888181-97888203 ACGTGGGAGGTCCATCTCTAGGG + Exonic
1046906679 8:119581373-119581395 GCCTGGGAGGCTGACCTCTAGGG + Intronic
1047208519 8:122822053-122822075 GCCTCGGAGGCCCAACAGTAAGG + Intronic
1049303135 8:141882275-141882297 AGCTGGGAGGATCACCTCTAAGG - Intergenic
1056123608 9:83513342-83513364 ACCTCTGAGGAGCACGTCTAGGG + Intronic
1060114663 9:120930432-120930454 ACCTCAGAGGCCCACCTGGGAGG + Intergenic
1061264783 9:129498504-129498526 GCATCAGAGGCCCACCTCTCTGG - Intergenic
1062405759 9:136395529-136395551 ACCTGGGAGGCCCAGCTGTGGGG + Intronic
1187000247 X:15169300-15169322 CCCTAGGAGGCTGACCTCTATGG + Intergenic
1189427363 X:40913082-40913104 GCCTGGGAGGCTGACCTCTATGG - Intergenic
1192533114 X:71906364-71906386 CCCTTGGAGGCCCAGCTCTGGGG + Intergenic
1200001272 X:153061481-153061503 AGCTAGTAGGCCCAGCTCTAGGG - Intergenic