ID: 952971519

View in Genome Browser
Species Human (GRCh38)
Location 3:38653797-38653819
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952971519_952971533 27 Left 952971519 3:38653797-38653819 CCTTGCCCAGCCCTCCCCAGCAG No data
Right 952971533 3:38653847-38653869 TATCTGTGAGCTCTAGATGGAGG No data
952971519_952971529 3 Left 952971519 3:38653797-38653819 CCTTGCCCAGCCCTCCCCAGCAG No data
Right 952971529 3:38653823-38653845 CTGGTCCTGCCTCATGCAGATGG No data
952971519_952971534 28 Left 952971519 3:38653797-38653819 CCTTGCCCAGCCCTCCCCAGCAG No data
Right 952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG No data
952971519_952971532 24 Left 952971519 3:38653797-38653819 CCTTGCCCAGCCCTCCCCAGCAG No data
Right 952971532 3:38653844-38653866 GGCTATCTGTGAGCTCTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952971519 Original CRISPR CTGCTGGGGAGGGCTGGGCA AGG (reversed) Intergenic
No off target data available for this crispr