ID: 952971521

View in Genome Browser
Species Human (GRCh38)
Location 3:38653802-38653824
Sequence AGCCTCTGCTGGGGAGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952971521_952971535 30 Left 952971521 3:38653802-38653824 CCCAGCCCTCCCCAGCAGAGGCT No data
Right 952971535 3:38653855-38653877 AGCTCTAGATGGAGGGCATCTGG No data
952971521_952971529 -2 Left 952971521 3:38653802-38653824 CCCAGCCCTCCCCAGCAGAGGCT No data
Right 952971529 3:38653823-38653845 CTGGTCCTGCCTCATGCAGATGG No data
952971521_952971534 23 Left 952971521 3:38653802-38653824 CCCAGCCCTCCCCAGCAGAGGCT No data
Right 952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG No data
952971521_952971532 19 Left 952971521 3:38653802-38653824 CCCAGCCCTCCCCAGCAGAGGCT No data
Right 952971532 3:38653844-38653866 GGCTATCTGTGAGCTCTAGATGG No data
952971521_952971533 22 Left 952971521 3:38653802-38653824 CCCAGCCCTCCCCAGCAGAGGCT No data
Right 952971533 3:38653847-38653869 TATCTGTGAGCTCTAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952971521 Original CRISPR AGCCTCTGCTGGGGAGGGCT GGG (reversed) Intergenic
No off target data available for this crispr