ID: 952971526

View in Genome Browser
Species Human (GRCh38)
Location 3:38653811-38653833
Sequence GGCAGGACCAGCCTCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952971526_952971533 13 Left 952971526 3:38653811-38653833 CCCCAGCAGAGGCTGGTCCTGCC No data
Right 952971533 3:38653847-38653869 TATCTGTGAGCTCTAGATGGAGG No data
952971526_952971532 10 Left 952971526 3:38653811-38653833 CCCCAGCAGAGGCTGGTCCTGCC No data
Right 952971532 3:38653844-38653866 GGCTATCTGTGAGCTCTAGATGG No data
952971526_952971536 29 Left 952971526 3:38653811-38653833 CCCCAGCAGAGGCTGGTCCTGCC No data
Right 952971536 3:38653863-38653885 ATGGAGGGCATCTGGCACAGTGG No data
952971526_952971534 14 Left 952971526 3:38653811-38653833 CCCCAGCAGAGGCTGGTCCTGCC No data
Right 952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG No data
952971526_952971535 21 Left 952971526 3:38653811-38653833 CCCCAGCAGAGGCTGGTCCTGCC No data
Right 952971535 3:38653855-38653877 AGCTCTAGATGGAGGGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952971526 Original CRISPR GGCAGGACCAGCCTCTGCTG GGG (reversed) Intergenic
No off target data available for this crispr