ID: 952971528

View in Genome Browser
Species Human (GRCh38)
Location 3:38653813-38653835
Sequence GAGGCAGGACCAGCCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952971528_952971535 19 Left 952971528 3:38653813-38653835 CCAGCAGAGGCTGGTCCTGCCTC No data
Right 952971535 3:38653855-38653877 AGCTCTAGATGGAGGGCATCTGG No data
952971528_952971533 11 Left 952971528 3:38653813-38653835 CCAGCAGAGGCTGGTCCTGCCTC No data
Right 952971533 3:38653847-38653869 TATCTGTGAGCTCTAGATGGAGG No data
952971528_952971532 8 Left 952971528 3:38653813-38653835 CCAGCAGAGGCTGGTCCTGCCTC No data
Right 952971532 3:38653844-38653866 GGCTATCTGTGAGCTCTAGATGG No data
952971528_952971534 12 Left 952971528 3:38653813-38653835 CCAGCAGAGGCTGGTCCTGCCTC No data
Right 952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG No data
952971528_952971537 30 Left 952971528 3:38653813-38653835 CCAGCAGAGGCTGGTCCTGCCTC No data
Right 952971537 3:38653866-38653888 GAGGGCATCTGGCACAGTGGAGG No data
952971528_952971536 27 Left 952971528 3:38653813-38653835 CCAGCAGAGGCTGGTCCTGCCTC No data
Right 952971536 3:38653863-38653885 ATGGAGGGCATCTGGCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952971528 Original CRISPR GAGGCAGGACCAGCCTCTGC TGG (reversed) Intergenic
No off target data available for this crispr