ID: 952971529

View in Genome Browser
Species Human (GRCh38)
Location 3:38653823-38653845
Sequence CTGGTCCTGCCTCATGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952971525_952971529 -8 Left 952971525 3:38653808-38653830 CCTCCCCAGCAGAGGCTGGTCCT No data
Right 952971529 3:38653823-38653845 CTGGTCCTGCCTCATGCAGATGG No data
952971518_952971529 12 Left 952971518 3:38653788-38653810 CCAGAAACGCCTTGCCCAGCCCT No data
Right 952971529 3:38653823-38653845 CTGGTCCTGCCTCATGCAGATGG No data
952971516_952971529 21 Left 952971516 3:38653779-38653801 CCAGCAGACCCAGAAACGCCTTG No data
Right 952971529 3:38653823-38653845 CTGGTCCTGCCTCATGCAGATGG No data
952971517_952971529 13 Left 952971517 3:38653787-38653809 CCCAGAAACGCCTTGCCCAGCCC No data
Right 952971529 3:38653823-38653845 CTGGTCCTGCCTCATGCAGATGG No data
952971519_952971529 3 Left 952971519 3:38653797-38653819 CCTTGCCCAGCCCTCCCCAGCAG No data
Right 952971529 3:38653823-38653845 CTGGTCCTGCCTCATGCAGATGG No data
952971524_952971529 -7 Left 952971524 3:38653807-38653829 CCCTCCCCAGCAGAGGCTGGTCC No data
Right 952971529 3:38653823-38653845 CTGGTCCTGCCTCATGCAGATGG No data
952971522_952971529 -3 Left 952971522 3:38653803-38653825 CCAGCCCTCCCCAGCAGAGGCTG No data
Right 952971529 3:38653823-38653845 CTGGTCCTGCCTCATGCAGATGG No data
952971521_952971529 -2 Left 952971521 3:38653802-38653824 CCCAGCCCTCCCCAGCAGAGGCT No data
Right 952971529 3:38653823-38653845 CTGGTCCTGCCTCATGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952971529 Original CRISPR CTGGTCCTGCCTCATGCAGA TGG Intergenic
No off target data available for this crispr