ID: 952971531

View in Genome Browser
Species Human (GRCh38)
Location 3:38653832-38653854
Sequence CACAGATAGCCATCTGCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952971531_952971534 -7 Left 952971531 3:38653832-38653854 CCTCATGCAGATGGCTATCTGTG No data
Right 952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG No data
952971531_952971539 22 Left 952971531 3:38653832-38653854 CCTCATGCAGATGGCTATCTGTG No data
Right 952971539 3:38653877-38653899 GCACAGTGGAGGCAGGCTTGAGG No data
952971531_952971533 -8 Left 952971531 3:38653832-38653854 CCTCATGCAGATGGCTATCTGTG No data
Right 952971533 3:38653847-38653869 TATCTGTGAGCTCTAGATGGAGG No data
952971531_952971538 15 Left 952971531 3:38653832-38653854 CCTCATGCAGATGGCTATCTGTG No data
Right 952971538 3:38653870-38653892 GCATCTGGCACAGTGGAGGCAGG No data
952971531_952971537 11 Left 952971531 3:38653832-38653854 CCTCATGCAGATGGCTATCTGTG No data
Right 952971537 3:38653866-38653888 GAGGGCATCTGGCACAGTGGAGG No data
952971531_952971535 0 Left 952971531 3:38653832-38653854 CCTCATGCAGATGGCTATCTGTG No data
Right 952971535 3:38653855-38653877 AGCTCTAGATGGAGGGCATCTGG No data
952971531_952971536 8 Left 952971531 3:38653832-38653854 CCTCATGCAGATGGCTATCTGTG No data
Right 952971536 3:38653863-38653885 ATGGAGGGCATCTGGCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952971531 Original CRISPR CACAGATAGCCATCTGCATG AGG (reversed) Intergenic
No off target data available for this crispr