ID: 952971534

View in Genome Browser
Species Human (GRCh38)
Location 3:38653848-38653870
Sequence ATCTGTGAGCTCTAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952971519_952971534 28 Left 952971519 3:38653797-38653819 CCTTGCCCAGCCCTCCCCAGCAG No data
Right 952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG No data
952971528_952971534 12 Left 952971528 3:38653813-38653835 CCAGCAGAGGCTGGTCCTGCCTC No data
Right 952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG No data
952971531_952971534 -7 Left 952971531 3:38653832-38653854 CCTCATGCAGATGGCTATCTGTG No data
Right 952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG No data
952971527_952971534 13 Left 952971527 3:38653812-38653834 CCCAGCAGAGGCTGGTCCTGCCT No data
Right 952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG No data
952971524_952971534 18 Left 952971524 3:38653807-38653829 CCCTCCCCAGCAGAGGCTGGTCC No data
Right 952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG No data
952971526_952971534 14 Left 952971526 3:38653811-38653833 CCCCAGCAGAGGCTGGTCCTGCC No data
Right 952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG No data
952971521_952971534 23 Left 952971521 3:38653802-38653824 CCCAGCCCTCCCCAGCAGAGGCT No data
Right 952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG No data
952971522_952971534 22 Left 952971522 3:38653803-38653825 CCAGCCCTCCCCAGCAGAGGCTG No data
Right 952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG No data
952971530_952971534 -3 Left 952971530 3:38653828-38653850 CCTGCCTCATGCAGATGGCTATC No data
Right 952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG No data
952971525_952971534 17 Left 952971525 3:38653808-38653830 CCTCCCCAGCAGAGGCTGGTCCT No data
Right 952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952971534 Original CRISPR ATCTGTGAGCTCTAGATGGA GGG Intergenic
No off target data available for this crispr