ID: 952971536

View in Genome Browser
Species Human (GRCh38)
Location 3:38653863-38653885
Sequence ATGGAGGGCATCTGGCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952971526_952971536 29 Left 952971526 3:38653811-38653833 CCCCAGCAGAGGCTGGTCCTGCC No data
Right 952971536 3:38653863-38653885 ATGGAGGGCATCTGGCACAGTGG No data
952971527_952971536 28 Left 952971527 3:38653812-38653834 CCCAGCAGAGGCTGGTCCTGCCT No data
Right 952971536 3:38653863-38653885 ATGGAGGGCATCTGGCACAGTGG No data
952971530_952971536 12 Left 952971530 3:38653828-38653850 CCTGCCTCATGCAGATGGCTATC No data
Right 952971536 3:38653863-38653885 ATGGAGGGCATCTGGCACAGTGG No data
952971528_952971536 27 Left 952971528 3:38653813-38653835 CCAGCAGAGGCTGGTCCTGCCTC No data
Right 952971536 3:38653863-38653885 ATGGAGGGCATCTGGCACAGTGG No data
952971531_952971536 8 Left 952971531 3:38653832-38653854 CCTCATGCAGATGGCTATCTGTG No data
Right 952971536 3:38653863-38653885 ATGGAGGGCATCTGGCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952971536 Original CRISPR ATGGAGGGCATCTGGCACAG TGG Intergenic
No off target data available for this crispr