ID: 952971538

View in Genome Browser
Species Human (GRCh38)
Location 3:38653870-38653892
Sequence GCATCTGGCACAGTGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952971531_952971538 15 Left 952971531 3:38653832-38653854 CCTCATGCAGATGGCTATCTGTG No data
Right 952971538 3:38653870-38653892 GCATCTGGCACAGTGGAGGCAGG No data
952971530_952971538 19 Left 952971530 3:38653828-38653850 CCTGCCTCATGCAGATGGCTATC No data
Right 952971538 3:38653870-38653892 GCATCTGGCACAGTGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952971538 Original CRISPR GCATCTGGCACAGTGGAGGC AGG Intergenic
No off target data available for this crispr