ID: 952971539

View in Genome Browser
Species Human (GRCh38)
Location 3:38653877-38653899
Sequence GCACAGTGGAGGCAGGCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952971530_952971539 26 Left 952971530 3:38653828-38653850 CCTGCCTCATGCAGATGGCTATC No data
Right 952971539 3:38653877-38653899 GCACAGTGGAGGCAGGCTTGAGG No data
952971531_952971539 22 Left 952971531 3:38653832-38653854 CCTCATGCAGATGGCTATCTGTG No data
Right 952971539 3:38653877-38653899 GCACAGTGGAGGCAGGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952971539 Original CRISPR GCACAGTGGAGGCAGGCTTG AGG Intergenic
No off target data available for this crispr