ID: 952974345

View in Genome Browser
Species Human (GRCh38)
Location 3:38681415-38681437
Sequence ATCTATAGCAAGCCTGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952974338_952974345 25 Left 952974338 3:38681367-38681389 CCACAACTCACATAAGCTAGAGG No data
Right 952974345 3:38681415-38681437 ATCTATAGCAAGCCTGGAGATGG No data
952974337_952974345 29 Left 952974337 3:38681363-38681385 CCTTCCACAACTCACATAAGCTA No data
Right 952974345 3:38681415-38681437 ATCTATAGCAAGCCTGGAGATGG No data
952974336_952974345 30 Left 952974336 3:38681362-38681384 CCCTTCCACAACTCACATAAGCT No data
Right 952974345 3:38681415-38681437 ATCTATAGCAAGCCTGGAGATGG No data
952974341_952974345 -7 Left 952974341 3:38681399-38681421 CCTTTCTCCAGGAGCCATCTATA No data
Right 952974345 3:38681415-38681437 ATCTATAGCAAGCCTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952974345 Original CRISPR ATCTATAGCAAGCCTGGAGA TGG Intergenic
No off target data available for this crispr