ID: 952975058

View in Genome Browser
Species Human (GRCh38)
Location 3:38686853-38686875
Sequence TGGGATCTCATACATGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952975058_952975065 19 Left 952975058 3:38686853-38686875 CCAAGTTCATGTATGAGATCCCA No data
Right 952975065 3:38686895-38686917 GTTGTGGCTCACGATTAGATAGG No data
952975058_952975063 -3 Left 952975058 3:38686853-38686875 CCAAGTTCATGTATGAGATCCCA No data
Right 952975063 3:38686873-38686895 CCAGAGGGTGTTAAGTGCTGTGG No data
952975058_952975067 27 Left 952975058 3:38686853-38686875 CCAAGTTCATGTATGAGATCCCA No data
Right 952975067 3:38686903-38686925 TCACGATTAGATAGGCCGGTCGG No data
952975058_952975066 23 Left 952975058 3:38686853-38686875 CCAAGTTCATGTATGAGATCCCA No data
Right 952975066 3:38686899-38686921 TGGCTCACGATTAGATAGGCCGG No data
952975058_952975064 3 Left 952975058 3:38686853-38686875 CCAAGTTCATGTATGAGATCCCA No data
Right 952975064 3:38686879-38686901 GGTGTTAAGTGCTGTGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952975058 Original CRISPR TGGGATCTCATACATGAACT TGG (reversed) Intergenic
No off target data available for this crispr