ID: 952975061

View in Genome Browser
Species Human (GRCh38)
Location 3:38686872-38686894
Sequence CACAGCACTTAACACCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952975061_952975066 4 Left 952975061 3:38686872-38686894 CCCAGAGGGTGTTAAGTGCTGTG No data
Right 952975066 3:38686899-38686921 TGGCTCACGATTAGATAGGCCGG No data
952975061_952975067 8 Left 952975061 3:38686872-38686894 CCCAGAGGGTGTTAAGTGCTGTG No data
Right 952975067 3:38686903-38686925 TCACGATTAGATAGGCCGGTCGG No data
952975061_952975065 0 Left 952975061 3:38686872-38686894 CCCAGAGGGTGTTAAGTGCTGTG No data
Right 952975065 3:38686895-38686917 GTTGTGGCTCACGATTAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952975061 Original CRISPR CACAGCACTTAACACCCTCT GGG (reversed) Intergenic
No off target data available for this crispr