ID: 952975062

View in Genome Browser
Species Human (GRCh38)
Location 3:38686873-38686895
Sequence CCACAGCACTTAACACCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952975062_952975069 30 Left 952975062 3:38686873-38686895 CCAGAGGGTGTTAAGTGCTGTGG No data
Right 952975069 3:38686926-38686948 AGAAGAACTGAAGAAAGCACAGG No data
952975062_952975065 -1 Left 952975062 3:38686873-38686895 CCAGAGGGTGTTAAGTGCTGTGG No data
Right 952975065 3:38686895-38686917 GTTGTGGCTCACGATTAGATAGG No data
952975062_952975067 7 Left 952975062 3:38686873-38686895 CCAGAGGGTGTTAAGTGCTGTGG No data
Right 952975067 3:38686903-38686925 TCACGATTAGATAGGCCGGTCGG No data
952975062_952975066 3 Left 952975062 3:38686873-38686895 CCAGAGGGTGTTAAGTGCTGTGG No data
Right 952975066 3:38686899-38686921 TGGCTCACGATTAGATAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952975062 Original CRISPR CCACAGCACTTAACACCCTC TGG (reversed) Intergenic
No off target data available for this crispr