ID: 952975063

View in Genome Browser
Species Human (GRCh38)
Location 3:38686873-38686895
Sequence CCAGAGGGTGTTAAGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952975057_952975063 3 Left 952975057 3:38686847-38686869 CCATAGCCAAGTTCATGTATGAG No data
Right 952975063 3:38686873-38686895 CCAGAGGGTGTTAAGTGCTGTGG No data
952975058_952975063 -3 Left 952975058 3:38686853-38686875 CCAAGTTCATGTATGAGATCCCA No data
Right 952975063 3:38686873-38686895 CCAGAGGGTGTTAAGTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952975063 Original CRISPR CCAGAGGGTGTTAAGTGCTG TGG Intergenic
No off target data available for this crispr