ID: 952975066

View in Genome Browser
Species Human (GRCh38)
Location 3:38686899-38686921
Sequence TGGCTCACGATTAGATAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952975058_952975066 23 Left 952975058 3:38686853-38686875 CCAAGTTCATGTATGAGATCCCA No data
Right 952975066 3:38686899-38686921 TGGCTCACGATTAGATAGGCCGG No data
952975061_952975066 4 Left 952975061 3:38686872-38686894 CCCAGAGGGTGTTAAGTGCTGTG No data
Right 952975066 3:38686899-38686921 TGGCTCACGATTAGATAGGCCGG No data
952975062_952975066 3 Left 952975062 3:38686873-38686895 CCAGAGGGTGTTAAGTGCTGTGG No data
Right 952975066 3:38686899-38686921 TGGCTCACGATTAGATAGGCCGG No data
952975057_952975066 29 Left 952975057 3:38686847-38686869 CCATAGCCAAGTTCATGTATGAG No data
Right 952975066 3:38686899-38686921 TGGCTCACGATTAGATAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952975066 Original CRISPR TGGCTCACGATTAGATAGGC CGG Intergenic
No off target data available for this crispr