ID: 952975067

View in Genome Browser
Species Human (GRCh38)
Location 3:38686903-38686925
Sequence TCACGATTAGATAGGCCGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952975062_952975067 7 Left 952975062 3:38686873-38686895 CCAGAGGGTGTTAAGTGCTGTGG No data
Right 952975067 3:38686903-38686925 TCACGATTAGATAGGCCGGTCGG No data
952975061_952975067 8 Left 952975061 3:38686872-38686894 CCCAGAGGGTGTTAAGTGCTGTG No data
Right 952975067 3:38686903-38686925 TCACGATTAGATAGGCCGGTCGG No data
952975058_952975067 27 Left 952975058 3:38686853-38686875 CCAAGTTCATGTATGAGATCCCA No data
Right 952975067 3:38686903-38686925 TCACGATTAGATAGGCCGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952975067 Original CRISPR TCACGATTAGATAGGCCGGT CGG Intergenic
No off target data available for this crispr