ID: 952975069

View in Genome Browser
Species Human (GRCh38)
Location 3:38686926-38686948
Sequence AGAAGAACTGAAGAAAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952975062_952975069 30 Left 952975062 3:38686873-38686895 CCAGAGGGTGTTAAGTGCTGTGG No data
Right 952975069 3:38686926-38686948 AGAAGAACTGAAGAAAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952975069 Original CRISPR AGAAGAACTGAAGAAAGCAC AGG Intergenic
No off target data available for this crispr