ID: 952978182

View in Genome Browser
Species Human (GRCh38)
Location 3:38713957-38713979
Sequence TTCTCGATTTGAAGGCATGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952978182_952978193 26 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978193 3:38714006-38714028 AAGGGTTCGAAGGGCTTTGATGG 0: 1
1: 0
2: 0
3: 12
4: 114
952978182_952978191 16 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978191 3:38713996-38714018 GCAGAGCGCGAAGGGTTCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
952978182_952978192 17 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 23
952978182_952978189 8 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978189 3:38713988-38714010 CAGTGGCCGCAGAGCGCGAAGGG 0: 1
1: 0
2: 0
3: 1
4: 62
952978182_952978194 27 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978194 3:38714007-38714029 AGGGTTCGAAGGGCTTTGATGGG 0: 1
1: 0
2: 1
3: 4
4: 80
952978182_952978185 -9 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978185 3:38713971-38713993 AATCGAGAAAGAGCCCGCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 69
952978182_952978188 7 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978188 3:38713987-38714009 GCAGTGGCCGCAGAGCGCGAAGG 0: 1
1: 0
2: 0
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952978182 Original CRISPR TTCTCGATTTGAAGGCATGC GGG (reversed) Exonic