ID: 952978182

View in Genome Browser
Species Human (GRCh38)
Location 3:38713957-38713979
Sequence TTCTCGATTTGAAGGCATGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952978182_952978194 27 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978194 3:38714007-38714029 AGGGTTCGAAGGGCTTTGATGGG 0: 1
1: 0
2: 1
3: 4
4: 80
952978182_952978193 26 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978193 3:38714006-38714028 AAGGGTTCGAAGGGCTTTGATGG 0: 1
1: 0
2: 0
3: 12
4: 114
952978182_952978188 7 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978188 3:38713987-38714009 GCAGTGGCCGCAGAGCGCGAAGG 0: 1
1: 0
2: 0
3: 9
4: 99
952978182_952978192 17 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 23
952978182_952978189 8 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978189 3:38713988-38714010 CAGTGGCCGCAGAGCGCGAAGGG 0: 1
1: 0
2: 0
3: 1
4: 62
952978182_952978191 16 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978191 3:38713996-38714018 GCAGAGCGCGAAGGGTTCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
952978182_952978185 -9 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978185 3:38713971-38713993 AATCGAGAAAGAGCCCGCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952978182 Original CRISPR TTCTCGATTTGAAGGCATGC GGG (reversed) Exonic
901657049 1:10775435-10775457 GGCTCAATGTGAAGGCATGCGGG + Intronic
904334271 1:29786863-29786885 TTCTGGATTCTAAGGTATGCTGG + Intergenic
906724704 1:48035819-48035841 TTCTCAATGGGAGGGCATGCTGG - Intergenic
907870677 1:58439937-58439959 TGCTCCATGTGAAGTCATGCTGG - Intronic
908292444 1:62681879-62681901 TTCTCTTTTTGAAGTCATTCGGG - Intronic
910276398 1:85453914-85453936 TTCTGTATTTGAACACATGCTGG + Intronic
912676673 1:111688056-111688078 TTCACGATTTAAATGTATGCTGG + Intronic
918716278 1:187790825-187790847 TCCTGCAGTTGAAGGCATGCAGG + Intergenic
923009468 1:230076663-230076685 TTCTCAAGGTGAGGGCATGCAGG + Intronic
1066612496 10:37264689-37264711 TTCTCCATGTGTAGGCAAGCAGG + Intronic
1068679973 10:59809008-59809030 CTCTTTAATTGAAGGCATGCTGG + Intronic
1071726285 10:88201307-88201329 TTCTCTATTTGAACCCATGTTGG + Intergenic
1072495506 10:95953837-95953859 TGCTCCAGTTGAAGGCATACTGG + Intronic
1075613008 10:123868404-123868426 TTCTGGTTTTGAAGACATGGAGG - Intronic
1078401056 11:11027584-11027606 TTCTGGATTTGAATGCATTATGG - Intergenic
1083177995 11:60964794-60964816 TTCTGGATTTTAAAGCATCCTGG + Intergenic
1091685353 12:2557597-2557619 TTCTCCAGATGAAGGCATGGGGG - Intronic
1096455389 12:51780750-51780772 ATCACGATTTGAAGGGATGAGGG + Exonic
1102572371 12:113834794-113834816 TTCCCGGTCTGAAGGCATACCGG - Intronic
1106527622 13:30556079-30556101 TTCTCTCTTTGAAGACATACTGG - Intronic
1107660108 13:42630479-42630501 ATCTCAATTTCAAGGCAGGCAGG - Intergenic
1117330804 14:54710074-54710096 ATTTGGATTTGAAAGCATGCTGG + Intronic
1118917102 14:70116721-70116743 TTCTCCATTTGAAAGGAAGCTGG + Intronic
1119046387 14:71321314-71321336 TTTTCGATTTGGTGGCTTGCTGG + Intronic
1119612224 14:76073260-76073282 TTCTCCGTTTGAAGGCTGGCAGG + Intronic
1131088017 15:89594225-89594247 TTTTCGATTTGAACGAATGCAGG - Intronic
1135520656 16:23175054-23175076 TTCTAGATTTGTAGGAATCCTGG + Intergenic
1138079131 16:54072119-54072141 TTCTCTTGTGGAAGGCATGCCGG + Intronic
1139002638 16:62531710-62531732 GTCATGATTGGAAGGCATGCAGG + Intergenic
1142966539 17:3585451-3585473 TACTCGGTTAGAAAGCATGCAGG - Intronic
1143901850 17:10180473-10180495 TTCTCGATTTGTGGGCATCTTGG - Intronic
1146483380 17:33223603-33223625 TTCCCTTTTTGAAGCCATGCTGG - Intronic
1154514255 18:15144450-15144472 ATCTCAATTTGAGGTCATGCTGG + Intergenic
1155176832 18:23308158-23308180 ACCTCGATTTGAAGGCCTGGGGG + Intronic
1157154705 18:45254570-45254592 TTCATGCTTTGAAGGCCTGCAGG + Intronic
1159117547 18:64132884-64132906 TTCTGGTTGTGAAGTCATGCTGG - Intergenic
925339121 2:3123059-3123081 TTGTGGATCTGAGGGCATGCTGG - Intergenic
926388173 2:12359410-12359432 TTCCCGAATGGAAGGCGTGCAGG - Intergenic
929181709 2:39047637-39047659 TTATTGATTTGTAGGCATGTAGG + Intronic
929732693 2:44512649-44512671 TTCTCTATTGGAAGGCCAGCTGG + Intronic
938132051 2:128725067-128725089 GTCTCCATTTGAAGGCAGGCTGG - Intergenic
938514496 2:131989060-131989082 ATCTCAATTTGAGGTCATGCTGG + Intergenic
941406832 2:165100301-165100323 ATCCCGGTTTGAAGGCATGAGGG - Exonic
941480849 2:166009718-166009740 ATCTCGATTTGAAGGGATGAGGG - Exonic
941498145 2:166233339-166233361 ATCTAGATTTGAAGGAATGAGGG - Exonic
943237628 2:185342854-185342876 TTCTTTATATGATGGCATGCAGG + Intergenic
944523892 2:200598858-200598880 TTCTAGATTTGAAGGAATCTTGG + Intronic
944787470 2:203087805-203087827 TGGTCTATTTGAAGGCAAGCAGG + Intronic
1171182346 20:23100051-23100073 TTCTAGATCTTCAGGCATGCTGG - Intergenic
1171998469 20:31752227-31752249 TTCTTGCCTTGAAGGCAAGCTGG - Intronic
1173088654 20:39949597-39949619 TTCTCTATTTGAAGGGTGGCTGG + Intergenic
1173620178 20:44430390-44430412 TTCTCGGGTTGAAGGCCTTCAGG - Exonic
1174036383 20:47671035-47671057 TTCTTGTTTTAAAGTCATGCAGG + Intronic
1175242192 20:57557803-57557825 TTCTACATTTGAAGGGATGATGG - Intergenic
1176779276 21:13173840-13173862 ATCTCAATTTGAGGTCATGCTGG - Intergenic
1181152195 22:20892595-20892617 TTGTTGAGTTGAAGGCATGGAGG - Intergenic
951612059 3:24500975-24500997 TTCTCAATTTGAGGGCAAGATGG + Intergenic
952956753 3:38562414-38562436 GTCACGATTTGAGGGCATGAGGG - Exonic
952978182 3:38713957-38713979 TTCTCGATTTGAAGGCATGCGGG - Exonic
954633149 3:52057545-52057567 GTGTCGATTTGCAGGCAGGCGGG + Intergenic
966447559 3:180020082-180020104 TTCTGGTTTTGAAGACATGGGGG - Intronic
966548480 3:181178694-181178716 TTCTGCATTTGAAGACATGATGG - Intergenic
978284139 4:107054821-107054843 TTCTCTACTTGAAGCCATGGGGG - Intronic
979076874 4:116282305-116282327 TTCTTGATCTGCAGGCATTCTGG - Intergenic
980965718 4:139518793-139518815 TTGTAGATAAGAAGGCATGCTGG - Intronic
994361071 5:98849187-98849209 TTCTAAATTAGAAAGCATGCTGG - Intergenic
1010348825 6:74846984-74847006 TTCTCGAGTTGTTGGCATGGTGG + Intergenic
1011705922 6:90001488-90001510 TTCTGGATGTGAAGGCAATCTGG - Intronic
1014994876 6:128130321-128130343 TTCTTGATTTGAAGAAAGGCAGG - Intronic
1021749937 7:23786902-23786924 TTCTGAATTTAAAGGCATGTTGG - Exonic
1022590228 7:31654479-31654501 TTTACGTTTTGAAGTCATGCTGG + Intronic
1034239109 7:149596134-149596156 CCCTCCATTTGAAGGCAAGCAGG - Intergenic
1058474815 9:105322194-105322216 TTCTGGTTTTGAAGGCAGGAAGG + Intronic
1187570795 X:20499171-20499193 TGGTCGATTTGAATGCATCCAGG + Intergenic
1188997306 X:36901424-36901446 TTCTGTATTTGAAAGCATTCAGG - Intergenic
1201412805 Y:13717479-13717501 TTCTCCCTTTGAAGGCTAGCAGG + Intergenic