ID: 952978183

View in Genome Browser
Species Human (GRCh38)
Location 3:38713958-38713980
Sequence TTTCTCGATTTGAAGGCATG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952978183_952978189 7 Left 952978183 3:38713958-38713980 CCGCATGCCTTCAAATCGAGAAA 0: 1
1: 0
2: 1
3: 15
4: 124
Right 952978189 3:38713988-38714010 CAGTGGCCGCAGAGCGCGAAGGG 0: 1
1: 0
2: 0
3: 1
4: 62
952978183_952978188 6 Left 952978183 3:38713958-38713980 CCGCATGCCTTCAAATCGAGAAA 0: 1
1: 0
2: 1
3: 15
4: 124
Right 952978188 3:38713987-38714009 GCAGTGGCCGCAGAGCGCGAAGG 0: 1
1: 0
2: 0
3: 9
4: 99
952978183_952978185 -10 Left 952978183 3:38713958-38713980 CCGCATGCCTTCAAATCGAGAAA 0: 1
1: 0
2: 1
3: 15
4: 124
Right 952978185 3:38713971-38713993 AATCGAGAAAGAGCCCGCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 69
952978183_952978193 25 Left 952978183 3:38713958-38713980 CCGCATGCCTTCAAATCGAGAAA 0: 1
1: 0
2: 1
3: 15
4: 124
Right 952978193 3:38714006-38714028 AAGGGTTCGAAGGGCTTTGATGG 0: 1
1: 0
2: 0
3: 12
4: 114
952978183_952978191 15 Left 952978183 3:38713958-38713980 CCGCATGCCTTCAAATCGAGAAA 0: 1
1: 0
2: 1
3: 15
4: 124
Right 952978191 3:38713996-38714018 GCAGAGCGCGAAGGGTTCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
952978183_952978192 16 Left 952978183 3:38713958-38713980 CCGCATGCCTTCAAATCGAGAAA 0: 1
1: 0
2: 1
3: 15
4: 124
Right 952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 23
952978183_952978194 26 Left 952978183 3:38713958-38713980 CCGCATGCCTTCAAATCGAGAAA 0: 1
1: 0
2: 1
3: 15
4: 124
Right 952978194 3:38714007-38714029 AGGGTTCGAAGGGCTTTGATGGG 0: 1
1: 0
2: 1
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952978183 Original CRISPR TTTCTCGATTTGAAGGCATG CGG (reversed) Exonic
900384239 1:2402192-2402214 TCTCCCCACTTGAAGGCATGCGG + Exonic
905790746 1:40787972-40787994 TTTCTCTATGTGAAGGTTTGCGG + Intronic
909496160 1:76281254-76281276 TTTCTCTCTTAGAAGGCCTGAGG + Intronic
912771296 1:112466194-112466216 TGTCTAGATTGGAAGCCATGTGG + Intergenic
912882881 1:113435869-113435891 TATTTTGATTTGAAAGCATGAGG + Intronic
916092821 1:161321628-161321650 TTTCCAGCTTTGAAGGCAAGAGG - Intronic
917712747 1:177703672-177703694 TTCCTCAGTTTGAACGCATGTGG - Intergenic
919211086 1:194487694-194487716 TTTCTTTATTTCTAGGCATGAGG + Intergenic
921528322 1:216246092-216246114 TTTATTAATTTGATGGCATGTGG + Intronic
922828455 1:228537867-228537889 TCTCTCCATTAGAAGGCCTGAGG + Intergenic
923867732 1:237957984-237958006 TGTCTAGATTGGAAGGCTTGAGG + Intergenic
1062782845 10:232015-232037 ATTCTCTATTTGCAGGCCTGAGG - Intronic
1064906362 10:20350330-20350352 TGTCTCGTTTTGCAGACATGTGG + Intergenic
1072647127 10:97265490-97265512 TTTCTTTTTTTGAAGGGATGGGG - Intronic
1078525642 11:12099039-12099061 TTTCTTGATTTGTAGAGATGTGG - Intronic
1080143703 11:28953456-28953478 TTTCACGAATTGAAGGTGTGTGG + Intergenic
1083988329 11:66231464-66231486 GTTCTCCTTTTGAAGGCCTGTGG + Intronic
1088047422 11:105471141-105471163 TTTCTCAATTCGCAGGCATATGG + Intergenic
1090272662 11:125398732-125398754 TTTCTCGGTTTGTAGGTTTGGGG - Intronic
1091685354 12:2557598-2557620 GTTCTCCAGATGAAGGCATGGGG - Intronic
1092019827 12:5192169-5192191 CTTCTCTCTTTAAAGGCATGAGG - Intergenic
1093960214 12:25264432-25264454 TTGCTTGAGTTGAAGGGATGAGG - Intergenic
1096455388 12:51780749-51780771 TATCACGATTTGAAGGGATGAGG + Exonic
1096834668 12:54342096-54342118 TTTCTCTCCTTCAAGGCATGGGG - Intronic
1097146105 12:56940299-56940321 TTCCTGGACTTGAAGGAATGAGG + Intergenic
1097151822 12:56984776-56984798 TTCCTGGACTTGAAGGAATGAGG + Intergenic
1098527398 12:71501541-71501563 ATTCTTGATATGAAGGCAAGAGG + Intronic
1098782055 12:74699898-74699920 TTTCTCTCTTTTAAGACATGGGG + Intergenic
1107408214 13:40135093-40135115 TTTCTTTTTTTGAAGGGATGAGG - Intergenic
1108529192 13:51313069-51313091 ATTCTAGATTTGAAGTCAAGAGG + Intergenic
1109689086 13:65863012-65863034 TTTCTAATTTTGCAGGCATGTGG - Intergenic
1112785614 13:102948189-102948211 TTCCCCGATTTGCATGCATGAGG - Intergenic
1114464582 14:22912459-22912481 TTTCTAGATGTGAAAGCTTGGGG - Intronic
1118025887 14:61768419-61768441 TATCTGAATTTGTAGGCATGTGG + Intronic
1119950321 14:78738027-78738049 TTTCTTGATTTTAAGGGTTGGGG + Intronic
1120356403 14:83440006-83440028 ATTCTAGAATTGAGGGCATGGGG - Intergenic
1120411524 14:84163049-84163071 TTTCTAGAATTGAAGGTAGGTGG + Intergenic
1120733053 14:88024035-88024057 CCTCTTGATTTGGAGGCATGAGG + Intergenic
1122182719 14:99967628-99967650 TTACTGGCTTTGAAGGCAGGAGG - Intergenic
1123908234 15:24941713-24941735 TTTGTTGATTCAAAGGCATGAGG + Intronic
1126447721 15:48767704-48767726 TATCTCTATTTGAAGGACTGGGG - Intronic
1126830749 15:52601967-52601989 TTTCCAGAATTGAAGACATGAGG - Intronic
1127145444 15:56018568-56018590 TTTCTTTTTTTGTAGGCATGTGG + Intergenic
1131907272 15:97156693-97156715 TATTTGGATTTAAAGGCATGAGG + Intergenic
1134306061 16:13033592-13033614 TCTCTTGATTTGAATGCAAGTGG - Intronic
1145741775 17:27280844-27280866 TTTCTGGATTTGCAGCGATGAGG - Intergenic
1147350870 17:39842187-39842209 ATTCTCCATTTAAAGGAATGAGG + Intronic
1150284412 17:63947045-63947067 TGTCCCGATTCGAGGGCATGAGG - Exonic
1151131088 17:71896559-71896581 TATCTCTATTTGAAGGCTTACGG - Intergenic
1151503899 17:74513397-74513419 GTTCTAGATTTGCAGGAATGAGG - Intergenic
1154486613 18:14876786-14876808 GTTCACTATTTAAAGGCATGGGG + Intergenic
1154929431 18:20976952-20976974 TTTGTAGATTTGGAGGCATAGGG - Intronic
1155176831 18:23308157-23308179 CACCTCGATTTGAAGGCCTGGGG + Intronic
1156727992 18:40152929-40152951 TTTCTTGATCTGAATACATGTGG - Intergenic
1157703343 18:49779503-49779525 TTTCTCGATGGGAAGGCTCGTGG - Intergenic
1168359495 19:55726866-55726888 TTTTTCAATTTCAAGGCATGTGG + Intronic
930362414 2:50398655-50398677 TGTTTCCATTTGCAGGCATGTGG + Intronic
933081929 2:78000696-78000718 TATCACGATTTGAAGAGATGAGG + Intergenic
934094046 2:88582175-88582197 TTTGTTGATTGGAAGGCATGAGG - Intronic
936880902 2:117249650-117249672 CCTCTTGATTTGATGGCATGAGG + Intergenic
941406833 2:165100302-165100324 TATCCCGGTTTGAAGGCATGAGG - Exonic
941427988 2:165373325-165373347 TGTCCCGGTTTGAAGGAATGAGG + Exonic
941480850 2:166009719-166009741 TATCTCGATTTGAAGGGATGAGG - Exonic
941498146 2:166233340-166233362 TATCTAGATTTGAAGGAATGAGG - Exonic
941861707 2:170288634-170288656 TTTCTAGATATGAAATCATGTGG + Intronic
1170329541 20:15193468-15193490 TTTTTATATTTGTAGGCATGGGG - Intronic
1173358227 20:42315580-42315602 TTTTTTAATTTAAAGGCATGAGG + Intronic
1176675165 21:9770851-9770873 TTTCTCTTTTTGTAGGTATGGGG - Intergenic
1176712678 21:10167658-10167680 TTTCTGGATGAAAAGGCATGAGG + Intergenic
1177300740 21:19242444-19242466 GTTCTGGAATTGCAGGCATGAGG + Intergenic
1177506219 21:22021156-22021178 TTTCTGGATCTGAAGGCCTCTGG - Intergenic
1177968320 21:27757487-27757509 TTTCACTATTTAAAGACATGGGG + Intergenic
1177987683 21:27998022-27998044 TTTGTCCAATAGAAGGCATGAGG + Intergenic
1182905603 22:33933346-33933368 TTTCTCAAATAGAAGGCAGGTGG + Intergenic
952956754 3:38562415-38562437 TGTCACGATTTGAGGGCATGAGG - Exonic
952978183 3:38713958-38713980 TTTCTCGATTTGAAGGCATGCGG - Exonic
954633148 3:52057544-52057566 TGTGTCGATTTGCAGGCAGGCGG + Intergenic
955711648 3:61785666-61785688 TGTGTCGAATTGAAAGCATGAGG + Intronic
958491704 3:94782814-94782836 GTTCTGGATTTACAGGCATGAGG - Intergenic
965150942 3:164974181-164974203 TTTCTCAATTCCAAAGCATGCGG - Intergenic
966447560 3:180020083-180020105 CTTCTGGTTTTGAAGACATGGGG - Intronic
967581186 3:191156704-191156726 TCTCTCCATTTGAAAGAATGAGG - Intergenic
973016520 4:45146214-45146236 TTTCTGGATGAAAAGGCATGAGG - Intergenic
974858294 4:67486981-67487003 TTTTTCTTTTTTAAGGCATGGGG + Intronic
975109300 4:70606222-70606244 TTCCAGGATTTGGAGGCATGAGG + Exonic
975382225 4:73714422-73714444 ATTCTGAAGTTGAAGGCATGTGG - Intergenic
976689186 4:87850348-87850370 TTTATCAATTTGTAGGCATATGG + Intergenic
978284140 4:107054822-107054844 TTTCTCTACTTGAAGCCATGGGG - Intronic
979421461 4:120509799-120509821 TTTCCCTGTTAGAAGGCATGGGG - Intergenic
986546515 5:8903900-8903922 TTTCTGGTTGTGAAGGCCTGAGG - Intergenic
986783864 5:11092417-11092439 TTTATCGATTTGGATGCATGTGG + Intronic
989584890 5:43066947-43066969 TTTCGCTATTTGAAGACATTAGG - Intronic
993278234 5:85890230-85890252 TTTCTTGATGTAAGGGCATGAGG + Intergenic
993945101 5:94109595-94109617 TTCCTTGATTTGGTGGCATGAGG - Intronic
995662872 5:114505364-114505386 TTTCTCTATTTAAAGACATTTGG - Intergenic
997593755 5:135092480-135092502 TTTCTCCACTTGAAAGAATGTGG + Intronic
997800193 5:136853206-136853228 TTTCTCCATCGGGAGGCATGGGG + Intergenic
998665563 5:144293190-144293212 TTTCTCTATTTGATGGTTTGTGG + Intronic
1000978343 5:167789410-167789432 TTCCTCGACTTGAATGGATGAGG + Intronic
1004494771 6:16153255-16153277 TTTCTTCATCTGAAGGAATGTGG - Intergenic
1008024904 6:46624293-46624315 TTTTTCCATTTGTAGACATGTGG + Intronic
1008757514 6:54815400-54815422 TTGCTGGATTTGAAGACATAAGG - Intergenic
1011644509 6:89445087-89445109 TTTCACGAATTGAAGGCTTGTGG + Intronic
1013191735 6:107809563-107809585 TTTCCCAATTGGAAGGCATGGGG + Intronic
1016745723 6:147577659-147577681 TTCCTGGTTTTGAAGGCATGAGG + Intronic
1016847255 6:148580746-148580768 TTTCACGAATTGAAGGCTTGGGG + Intergenic
1017659251 6:156657630-156657652 TTTCTGGATTTGAAGGGAATTGG - Intergenic
1018065303 6:160121550-160121572 TTTCTAGATGTGATGGTATGAGG - Intergenic
1024913498 7:54471761-54471783 TTTTTCTATTTGAAGGCAGGCGG - Intergenic
1025241436 7:57279564-57279586 TCTCTTGATTTGAAGCAATGTGG - Intergenic
1026965889 7:74439795-74439817 TTTCTCCATCTGAAGCCCTGTGG - Intergenic
1028090565 7:86695570-86695592 GTTCATGATTTGAAGCCATGTGG - Intronic
1031282714 7:119824195-119824217 TTTATTGATTTTAAGGAATGAGG + Intergenic
1036667184 8:10754747-10754769 TTTCTCTATTTTTAGGCACGTGG - Intronic
1039235800 8:35501371-35501393 TTTCTATACTTGAAGGCATAAGG + Intronic
1039515466 8:38128976-38128998 TTCCTGGCTTTGAAGGCCTGTGG + Intronic
1046436407 8:114195222-114195244 TTTTTTGATTTGGAGGCATGAGG + Intergenic
1050014007 9:1213849-1213871 TTACTCAATTTGCAGGAATGTGG - Intergenic
1053606866 9:39668766-39668788 TTTCTCTTTTTGAAGAAATGGGG - Intergenic
1053649685 9:40153458-40153480 TTTCTGGATGAAAAGGCATGAGG + Intergenic
1053756066 9:41310489-41310511 TTTCTGGATGAAAAGGCATGAGG - Intergenic
1053864783 9:42425390-42425412 TTTCTCTTTTTGAAGAAATGGGG - Intergenic
1053887543 9:42655596-42655618 GTTCACTATTTAAAGGCATGGGG + Intergenic
1054226565 9:62463046-62463068 GTTCACTATTTAAAGGCATGGGG + Intergenic
1054246669 9:62673636-62673658 TTTCTCTTTTTGAAGAAATGGGG + Intergenic
1054330196 9:63745221-63745243 TTTCTGGATGAAAAGGCATGAGG + Intergenic
1054534896 9:66222746-66222768 TTTCTGGATGAAAAGGCATGAGG - Intergenic
1054560791 9:66708170-66708192 TTTCTCTTTTTGAAGAAATGGGG + Intergenic
1058371772 9:104277158-104277180 TTTCTGGAGCTGTAGGCATGTGG - Intergenic
1058713040 9:107697577-107697599 TTTCTCAACTTGAAAACATGGGG + Intergenic
1202797425 9_KI270719v1_random:136648-136670 TTTCTGGATGAAAAGGCATGAGG + Intergenic
1186652453 X:11575595-11575617 GTGCTGGCTTTGAAGGCATGTGG - Intronic
1186700863 X:12088274-12088296 TTTCACGGTGTGAAGACATGGGG - Intergenic
1189206108 X:39240416-39240438 TTTCTCGGTTTGAAGAAGTGAGG - Intergenic
1191231415 X:58099013-58099035 TCTCTCCATTTGAATGCCTGGGG - Intergenic
1193812011 X:86063005-86063027 TTTCTAAATTTGAAGACATATGG - Intergenic
1196283317 X:113849815-113849837 TTTCTCATTTTGGAGGCATGGGG + Intergenic
1197154770 X:123258446-123258468 TTTCTATATAGGAAGGCATGTGG - Intronic
1197283061 X:124560845-124560867 TTCCTCGAGTAGAAGGTATGTGG + Intronic
1197515561 X:127423232-127423254 TTTCTCAATGGGAAGGCTTGTGG - Intergenic
1197971088 X:132115800-132115822 TTTCTGCATTTGGAGGAATGTGG - Intronic