ID: 952978184

View in Genome Browser
Species Human (GRCh38)
Location 3:38713965-38713987
Sequence CGGGCTCTTTCTCGATTTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952978184_952978194 19 Left 952978184 3:38713965-38713987 CCTTCAAATCGAGAAAGAGCCCG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 952978194 3:38714007-38714029 AGGGTTCGAAGGGCTTTGATGGG 0: 1
1: 0
2: 1
3: 4
4: 80
952978184_952978192 9 Left 952978184 3:38713965-38713987 CCTTCAAATCGAGAAAGAGCCCG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 23
952978184_952978191 8 Left 952978184 3:38713965-38713987 CCTTCAAATCGAGAAAGAGCCCG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 952978191 3:38713996-38714018 GCAGAGCGCGAAGGGTTCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
952978184_952978193 18 Left 952978184 3:38713965-38713987 CCTTCAAATCGAGAAAGAGCCCG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 952978193 3:38714006-38714028 AAGGGTTCGAAGGGCTTTGATGG 0: 1
1: 0
2: 0
3: 12
4: 114
952978184_952978188 -1 Left 952978184 3:38713965-38713987 CCTTCAAATCGAGAAAGAGCCCG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 952978188 3:38713987-38714009 GCAGTGGCCGCAGAGCGCGAAGG 0: 1
1: 0
2: 0
3: 9
4: 99
952978184_952978189 0 Left 952978184 3:38713965-38713987 CCTTCAAATCGAGAAAGAGCCCG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 952978189 3:38713988-38714010 CAGTGGCCGCAGAGCGCGAAGGG 0: 1
1: 0
2: 0
3: 1
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952978184 Original CRISPR CGGGCTCTTTCTCGATTTGA AGG (reversed) Exonic
906524025 1:46484074-46484096 GGGGCTCTTTCCTGGTTTGAAGG + Intergenic
911181321 1:94863081-94863103 AGGGCTGTTTCTAGTTTTGAGGG + Intronic
915089757 1:153416286-153416308 CTGGCTCAATCTTGATTTGAGGG - Intergenic
1065985436 10:30947188-30947210 TGAGCTCATTCTCGAGTTGAAGG + Intronic
1071797247 10:89020016-89020038 CAGGCTATTTCTCTGTTTGAAGG - Intergenic
1075953792 10:126505085-126505107 CGGGATCTTTTTCTATTTGCAGG - Exonic
1077863089 11:6200158-6200180 CGGGCTTTTTCTGAATGTGAAGG - Exonic
1082632449 11:55558243-55558265 CGGCCTCTTTCTCGATTTTCAGG - Intergenic
1087185315 11:95185928-95185950 CAGGTTCTTTCTCCATTAGAAGG - Intronic
1092307267 12:7314209-7314231 CTGGCTCTTTCTCCAACTGATGG - Intronic
1094541085 12:31363775-31363797 AGGGCTCTTTCTCACTTGGATGG - Intergenic
1097915781 12:65018977-65018999 CATTCTCTTTCTTGATTTGAGGG + Intergenic
1102187027 12:110957057-110957079 CGGGCTCCATCTCGAGTTTATGG + Intergenic
1102953776 12:117046618-117046640 CGGACTCCTTCTCGATGTGAGGG + Exonic
1113651694 13:112037760-112037782 GGGGCTCTTTCATGAGTTGAGGG + Intergenic
1117221866 14:53614145-53614167 AGTGCTCTGTCTCTATTTGATGG + Intergenic
1117293329 14:54354479-54354501 CAGGCTGTTTCTCTGTTTGAAGG + Intergenic
1119988360 14:79166283-79166305 CCGGCTCCTTCTCAGTTTGAGGG + Intronic
1122182017 14:99962264-99962286 CGGGCTCTCTCTGGAACTGATGG - Intergenic
1129619034 15:77126876-77126898 AGGGCTTTTCCTGGATTTGAAGG - Intronic
1129853046 15:78805782-78805804 CTGGCCATTTCTCCATTTGAAGG - Intronic
1130249918 15:82293255-82293277 CCGGCCATTTCTCCATTTGAAGG + Intergenic
1131894011 15:97006358-97006380 AGGGCTTTTTCTTGCTTTGATGG - Intergenic
1134275182 16:12769653-12769675 CGGGCTCATACTGGATGTGAAGG + Intronic
1136253428 16:29022632-29022654 TGGGCTGTTTCTGGATTTGCTGG + Intergenic
1136682874 16:31978128-31978150 CAGGCTCTTTCTGGGTATGAAGG - Intergenic
1136783512 16:32921694-32921716 CAGGCTCTTTCTGGGTATGAAGG - Intergenic
1136886277 16:33932155-33932177 CAGGCTCTTTCTGGGTATGAAGG + Intergenic
1141421663 16:83921589-83921611 CAGGCTCTTTCTCCTTATGATGG - Exonic
1203086161 16_KI270728v1_random:1185678-1185700 CAGGCTCTTTCTGGGTATGAAGG - Intergenic
1147466295 17:40613661-40613683 CGGCCTCTTTCTCCACTGGATGG + Intergenic
1149431197 17:56596414-56596436 CGGGCACTTTCTCCCCTTGAGGG + Intergenic
1150631344 17:66882546-66882568 TGGGCTCTTTCTCCTTTTCAAGG + Intronic
1155774810 18:29747449-29747471 TGGCCTCTTTTTGGATTTGACGG - Intergenic
1155804212 18:30145397-30145419 TGGCCTCTTTCTCGATTTTCAGG - Intergenic
1163284766 19:16339428-16339450 CGGGCTCTATCTCAAATGGATGG + Intergenic
1163680269 19:18677480-18677502 CTGGCTCCTTCTCGACTTGCAGG - Intergenic
1164260248 19:23563070-23563092 TGGGCTCTTTCTCTGTGTGAGGG + Intronic
938113721 2:128589501-128589523 CGCGCTCCTTCTGCATTTGAGGG + Intergenic
944565074 2:200981666-200981688 AGGGCTCTCACTGGATTTGATGG + Exonic
945178227 2:207064922-207064944 CGGGGTGTTTCTGGATCTGAAGG - Intergenic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
1171172052 20:23024139-23024161 CGGCCTCTTTCTCGATCTTCAGG + Intergenic
1174244759 20:49169766-49169788 CTGGTTCTTTCCCTATTTGAAGG + Intronic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1181390964 22:22580364-22580386 CAGGCTCTCTCTCGCTATGAAGG + Intergenic
1182392828 22:30013558-30013580 TGGGGACTTTCTCAATTTGAAGG + Intronic
952956755 3:38562422-38562444 AGAGCTCTGTCACGATTTGAGGG - Exonic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
956455325 3:69415260-69415282 GGGGCTTTATCTCCATTTGATGG - Intronic
968291199 3:197541106-197541128 AGGGCTGCTTCTCAATTTGAAGG + Intronic
989586198 5:43075480-43075502 CGGCCTCTTTCTCGATCTTCAGG + Intronic
999413527 5:151374180-151374202 CGGACTCTTTCTCGATCTTCAGG - Intergenic
1034535640 7:151724255-151724277 TGGGCTCTTTCTGCATTTGGGGG + Intronic
1037638068 8:20718364-20718386 CCAGCTCTGTCTCTATTTGAGGG + Intergenic
1039338900 8:36624873-36624895 GGGCTTCTTTCTCAATTTGATGG - Intergenic
1041638658 8:60173408-60173430 CGCGCTATTTCTCATTTTGATGG - Intergenic
1057757927 9:97852450-97852472 CAGGATCTGTCTCTATTTGATGG - Intergenic
1191225778 X:58041284-58041306 CTGGCTCTTTCTCATTTTGTGGG - Intergenic
1201400772 Y:13601782-13601804 CAGGCTGTTTCTCCATTTAAAGG - Intergenic