ID: 952978186

View in Genome Browser
Species Human (GRCh38)
Location 3:38713984-38714006
Sequence TCGCGCTCTGCGGCCACTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952978186_952978194 0 Left 952978186 3:38713984-38714006 CCCGCAGTGGCCGCAGAGCGCGA 0: 1
1: 0
2: 0
3: 10
4: 144
Right 952978194 3:38714007-38714029 AGGGTTCGAAGGGCTTTGATGGG 0: 1
1: 0
2: 1
3: 4
4: 80
952978186_952978193 -1 Left 952978186 3:38713984-38714006 CCCGCAGTGGCCGCAGAGCGCGA 0: 1
1: 0
2: 0
3: 10
4: 144
Right 952978193 3:38714006-38714028 AAGGGTTCGAAGGGCTTTGATGG 0: 1
1: 0
2: 0
3: 12
4: 114
952978186_952978192 -10 Left 952978186 3:38713984-38714006 CCCGCAGTGGCCGCAGAGCGCGA 0: 1
1: 0
2: 0
3: 10
4: 144
Right 952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952978186 Original CRISPR TCGCGCTCTGCGGCCACTGC GGG (reversed) Exonic
900109398 1:999213-999235 TCGGGCGCTGGGGCCTCTGCGGG + Exonic
900284063 1:1890902-1890924 GCGCGCTCCGCGGGCGCTGCGGG + Exonic
903129640 1:21270358-21270380 TCAGGCTCTGCGCCCCCTGCAGG + Intronic
904141600 1:28357746-28357768 TCTCGCTCTGTGGCCCCGGCTGG - Intergenic
904642989 1:31944609-31944631 TCGCACTCTGCGGCCTCCTCAGG + Intronic
905108397 1:35577324-35577346 TGGCCCTCCGCGGTCACTGCGGG + Intronic
908728310 1:67200067-67200089 TCTCGCTCTGTCGCCCCTGCTGG + Intronic
909606012 1:77508835-77508857 TCTCGCTCTGCCGCCAAGGCTGG - Intronic
910794201 1:91081675-91081697 TCTCGCTCTGTGGCCAGAGCTGG + Intergenic
912085951 1:106004159-106004181 TCGCGCTCTGTTGCCCATGCTGG - Intergenic
912610727 1:111040521-111040543 TCTCGCTCTGCCGCCCCAGCGGG - Intergenic
912610875 1:111042821-111042843 TCTCGCTCTGCCGCCCCAGCGGG + Intergenic
913592310 1:120341365-120341387 CCCCGCTCTGCCGCCGCTGCTGG + Intergenic
913651048 1:120913780-120913802 CCCCGCTCTGCCGCCGCTGCTGG - Intergenic
914525184 1:148459250-148459272 CCCCGCTCTGCCGCCGCTGCTGG + Intergenic
914598494 1:149176580-149176602 CCCCGCTCTGCCGCCGCTGCTGG - Intergenic
914641220 1:149607884-149607906 CCCCGCTCTGCCGCCGCTGCTGG - Intergenic
918892089 1:190287194-190287216 TCTCGCTCTGCGGCCCAGGCTGG - Intronic
920271050 1:204764001-204764023 TAGTGCTCTGCGCCCACCGCTGG - Intergenic
1072242740 10:93512195-93512217 TCTCGCTCTGTGGCCCCGGCTGG - Intronic
1074249089 10:111725716-111725738 TCATGCTCTGTGGCCACTCCAGG - Intergenic
1076220137 10:128727303-128727325 TGACTCTCTGCTGCCACTGCAGG + Intergenic
1077021098 11:417478-417500 TCCCGCTCTGCGCCCAAGGCTGG + Intergenic
1077107979 11:850099-850121 TCGCGCGCGGCGGCCCCTTCCGG + Intronic
1078105966 11:8358169-8358191 CCCGGCTCTGCGGCCACTGGTGG - Intergenic
1079162226 11:18005932-18005954 TAACCCTCTGCTGCCACTGCTGG + Intronic
1081865782 11:46359631-46359653 TCTCGCTCTGTGGCCAAGGCTGG + Intronic
1082061336 11:47862752-47862774 TCTCGCTCTGTGGCCCATGCTGG - Intergenic
1088626988 11:111736555-111736577 TCTCACTGTGCGGCCACTGCAGG + Intronic
1091740071 12:2954731-2954753 TCTCGCTCTGCTGCCCCGGCTGG - Intergenic
1092249949 12:6888814-6888836 TCTCGCTCTGCAGCCGCGGCTGG + Intronic
1093366153 12:18302208-18302230 CGGCCCTCTGCTGCCACTGCTGG - Intronic
1096332741 12:50728657-50728679 TCGCGCTCTGGTGTCTCTGCAGG + Exonic
1098844249 12:75516736-75516758 TCTCGCTCTGTTGCCAATGCTGG + Intergenic
1099890220 12:88580673-88580695 TCGCGGTCTCCCGCCAGTGCAGG - Intronic
1100225905 12:92555409-92555431 CCACGTGCTGCGGCCACTGCAGG + Intergenic
1100526025 12:95420274-95420296 TCTCACTCTGTGGCCAATGCTGG + Intergenic
1103320113 12:120087511-120087533 TCGAGCTAGGCGGCCTCTGCAGG + Intronic
1104092825 12:125529997-125530019 TCTCGCTCTGCGGCCCAGGCTGG - Intronic
1106987394 13:35372111-35372133 TGGCCCTCTGCTGCCACTGCTGG - Intronic
1107978615 13:45713787-45713809 TCGCGCGCTGCAGCAGCTGCTGG + Exonic
1112628463 13:101134138-101134160 TCTCGCTCTGTGGCCCATGCTGG - Intronic
1113522759 13:110952441-110952463 TCGCCCTCGGGAGCCACTGCAGG - Intergenic
1113697067 13:112354357-112354379 TGGCCCTCTGTGGCCACCGCAGG + Intergenic
1113702611 13:112398396-112398418 TCGCCCTCGGGAGCCACTGCAGG + Intronic
1114692778 14:24600703-24600725 TGGCCCACTGCTGCCACTGCTGG - Intergenic
1115819572 14:37199552-37199574 TCTCGCTCTGCCGCCAAGGCTGG + Intronic
1122760544 14:104021653-104021675 TCTCGCTCTGTCGCCAGTGCAGG - Intronic
1124844992 15:33281519-33281541 TCTCGCTCTGTGGCCAAGGCTGG + Intergenic
1125733721 15:41909228-41909250 TGGGGCTCTGCGGACGCTGCTGG - Intronic
1127985828 15:64069646-64069668 TCGCTCTCTGTCGCCCCTGCTGG - Intronic
1128620082 15:69141486-69141508 TAGCACTCTGTGGTCACTGCTGG - Intergenic
1130528317 15:84725877-84725899 TCTCGCTCTGCGGCCCAGGCTGG + Intergenic
1130563534 15:84976876-84976898 TCGCGCTCTGTGACCCATGCTGG - Intergenic
1133153158 16:3852192-3852214 TCTCGCTCTGCGGCCCAGGCTGG + Intronic
1133195411 16:4166545-4166567 TCTCGCTCTGCTGCCAAGGCTGG + Intergenic
1134090071 16:11386860-11386882 TCCCTCCCTGCGGGCACTGCTGG - Intronic
1136606373 16:31336972-31336994 TCTCGCTCTGCTGCCAAAGCTGG + Intergenic
1139774982 16:69311396-69311418 CCGCGCTCAGCGCCCACCGCCGG + Exonic
1139896489 16:70291779-70291801 TCTCGCTCTGCGGCCCAGGCTGG - Intronic
1140399299 16:74657503-74657525 TCTCGCTCTGCGGCCCAGGCTGG + Intronic
1141874921 16:86817473-86817495 TCGGGCTCTGCTGCCTCTCCTGG + Intergenic
1142507823 17:376420-376442 TCTCGCTCTGTTGCCAATGCTGG + Intronic
1142610465 17:1107033-1107055 TCTCCCTCTGAGGCCAATGCCGG + Intronic
1142617262 17:1143579-1143601 TCCGGCTCTGCCTCCACTGCTGG + Intronic
1146208093 17:30922079-30922101 ACGCGCACTGCGCCGACTGCGGG + Exonic
1147059764 17:37865748-37865770 TCTCGCTCTGTGGCCCATGCTGG - Intergenic
1147892836 17:43729438-43729460 TCTCGCTCTGCGGCCCAGGCTGG + Intergenic
1148627940 17:49084696-49084718 TCTCGCTCTGTGGCCCCGGCTGG + Intergenic
1151756284 17:76076992-76077014 CCGCGCTCTTCTGCCTCTGCTGG + Exonic
1152513189 17:80804174-80804196 GCCCCTTCTGCGGCCACTGCGGG - Intronic
1152689796 17:81712688-81712710 TCGAGCTCGGCGGCCACCACTGG - Intronic
1156275802 18:35581735-35581757 GCGCGCTCCTCGGCCACTGCCGG - Intronic
1156460344 18:37318190-37318212 CCTCCTTCTGCGGCCACTGCTGG + Intronic
1157763997 18:50284049-50284071 AAGGGCTCTGCTGCCACTGCTGG + Exonic
1158567950 18:58571054-58571076 TCTCGCTCTGTGGCCCATGCTGG + Intronic
1160499099 18:79393819-79393841 CCGGCCTCTGCGGCCACCGCGGG - Intergenic
1161197187 19:2993491-2993513 TGGTGCTTTGCAGCCACTGCTGG - Exonic
1161218337 19:3105891-3105913 TCCCGGTCTCAGGCCACTGCAGG - Intronic
1161273050 19:3400810-3400832 TCTCGCTCTGTGGCCCCAGCTGG - Intronic
1161957268 19:7503335-7503357 TCTCGCTCTGTGGCCCATGCTGG - Intronic
1162621479 19:11847776-11847798 TCGGGCTCTGCTGCCCCTGCAGG - Intergenic
1162926570 19:13933232-13933254 CGGGGCTCTGCGGCCGCTGCGGG - Exonic
1167241368 19:48345240-48345262 TCGGGCTCTGGAGCCCCTGCTGG - Exonic
1167569065 19:50275794-50275816 TCTCGCTCTGCTGCCCATGCTGG - Intronic
1168107971 19:54175752-54175774 TCTCGCTCTGCCGCCCATGCTGG + Intronic
929780824 2:44955770-44955792 GCGCGCTCTGGGGCCACTGGCGG + Intergenic
934714899 2:96537688-96537710 TCGCGCTCGGCGGGAGCTGCGGG + Intronic
935268912 2:101416814-101416836 TCGCGCTTGGAAGCCACTGCAGG + Intronic
941930548 2:170934765-170934787 TCTCGCTCTGTTGCCACGGCTGG + Intronic
1178472190 21:32903757-32903779 TCCCTCTCTGGGGTCACTGCAGG - Intergenic
1178764738 21:35439753-35439775 TCCTGCTCTGTGTCCACTGCCGG - Intronic
1179214525 21:39355615-39355637 TCTCGCTCTGCTGCCCATGCTGG + Intergenic
1181308614 22:21931276-21931298 TGCCGCTCTGCAGCCGCTGCAGG + Exonic
1182487873 22:30649999-30650021 GCGCTCTCTGTGCCCACTGCTGG - Intronic
1184200792 22:42967856-42967878 TCTCGCTCTGCGGCCCAGGCTGG - Intronic
950080879 3:10221281-10221303 TCGCGCTCTGTGGCCCAGGCTGG + Intronic
950220836 3:11194783-11194805 TCGCGCTCTGTCGCCCCAGCTGG - Intronic
950391363 3:12699350-12699372 TCTCGCTCTGTGGCCAAGGCTGG + Intergenic
952430572 3:33219112-33219134 GCGCGCTCTGCGGGTACAGCGGG + Exonic
952978186 3:38713984-38714006 TCGCGCTCTGCGGCCACTGCGGG - Exonic
955677669 3:61466012-61466034 TCTCGCTCTGCTGCCCATGCTGG + Intergenic
962594440 3:136926302-136926324 TCTCGCTCTGCGGCCCAGGCTGG + Intronic
964474794 3:157088889-157088911 TCTCGCTCTGCGGCCTGGGCTGG - Intergenic
966860692 3:184229775-184229797 GCGCGGGCCGCGGCCACTGCAGG + Intronic
967010654 3:185430123-185430145 TGGCTCTCTGCAGCCTCTGCTGG - Intronic
967059757 3:185861609-185861631 TCTCGCTCTGCTGCCCATGCTGG - Intergenic
968258065 3:197297593-197297615 CAGCGCTCTGCGGCCGCTGCTGG - Intronic
968324180 3:197797828-197797850 TCTCGCTCTGTTGCCAGTGCTGG - Intronic
972681245 4:41308974-41308996 TCTCGCTCTGTGGCCCCGGCTGG - Intergenic
974260473 4:59518740-59518762 CCGGGCCCTGCGGCCACTGCTGG - Intergenic
975358794 4:73441536-73441558 TCTCGCTCTGTGGCCCCGGCGGG - Intronic
975401500 4:73944282-73944304 CCGCGCTCCCCGGCTACTGCGGG - Intergenic
979832064 4:125315781-125315803 TGGGCCTCAGCGGCCACTGCCGG + Intergenic
980135075 4:128850958-128850980 TCTCGCTCTGTGGCCCATGCTGG + Intronic
989062595 5:37424117-37424139 TCTCCCTCTGCCGCCACGGCTGG - Intronic
989603634 5:43223107-43223129 TCTCGCTCTGTTGCCACGGCTGG - Intronic
989983307 5:50667514-50667536 CCCCGCTCTGCCGCCGCTGCTGG - Intronic
996178085 5:120385064-120385086 TCTCGCTCTGTGGCCAAGGCTGG + Intergenic
996406629 5:123111666-123111688 TCTCGCTCTGTCGCCCCTGCTGG - Intronic
997068234 5:130589120-130589142 TGGGGCTCTGAGGCCACTGGAGG + Intergenic
1000083351 5:157867918-157867940 GGGCCCTCTGTGGCCACTGCTGG + Intergenic
1001088288 5:168717688-168717710 TCTCGCTCTGTGGCCAAGGCTGG + Intronic
1002436069 5:179231883-179231905 TCTCGCTCTGTGGCCCCAGCTGG - Intronic
1003290778 6:4776616-4776638 TTGCACTCCGCGGCCAGTGCGGG - Exonic
1003893087 6:10580752-10580774 ACGAGCTCTGCTTCCACTGCAGG - Intronic
1005206343 6:23409881-23409903 TCGCGCTCTGCGGCCCAGGCTGG + Intergenic
1005605466 6:27472896-27472918 TCGCGCTTAGAGGCCTCTGCAGG - Intronic
1005925870 6:30445007-30445029 TCTCGCTCTGTGGCCCCGGCTGG - Intergenic
1006694627 6:35920789-35920811 TCGCGCCTTGGGGCCACTCCAGG - Intronic
1007103120 6:39264340-39264362 TCTCGCTCTGTGGCCCCAGCTGG - Intergenic
1009893160 6:69713644-69713666 TGGCGCTCTGCGTCCCCTGAAGG - Exonic
1015585640 6:134773314-134773336 TCTCGCTCTGCTGCCCCGGCTGG + Intergenic
1016957239 6:149638764-149638786 TCTCGCTCTGTGGCCCCGGCTGG + Intronic
1019292469 7:257446-257468 GCGGCCTCTGCGGCCGCTGCTGG + Intronic
1025028545 7:55537318-55537340 TGGCACTCTGCCCCCACTGCTGG + Intronic
1026538918 7:71263327-71263349 TCTCGCTCTGCGGCCAAGGCTGG - Intronic
1026650577 7:72212617-72212639 TCTCGCTTTGCTGCCCCTGCTGG - Intronic
1028013527 7:85679139-85679161 TTGCGTTCTGCAGCCTCTGCTGG - Intergenic
1030061904 7:105628761-105628783 TCTCGCTCTGTGGCCCCGGCTGG - Intronic
1032001964 7:128271523-128271545 CCGAGCTCTGAGGCCACAGCTGG + Intergenic
1032221807 7:130000231-130000253 TCTCGCTCTGTGGCCCATGCTGG + Intergenic
1040372116 8:46787632-46787654 TAGCACTCTGCTGCCACTGTGGG - Intergenic
1041292474 8:56320212-56320234 TCGCGCACTGGGGCTACGGCCGG - Exonic
1046148178 8:110189402-110189424 TAGCCCACTGCTGCCACTGCTGG - Intergenic
1049697282 8:143990415-143990437 CGGCGCGCTGCGGCGACTGCTGG + Intronic
1052703755 9:31969490-31969512 TCGCACTCAGCTGCCCCTGCTGG + Intergenic
1056237107 9:84605744-84605766 TCCCGCTTTGCCACCACTGCTGG + Intergenic
1057345857 9:94249810-94249832 TCTCGCTCTGTGGCCAAGGCTGG - Intergenic
1057664683 9:97036098-97036120 TCTCGCTCTGCGGCCCAGGCTGG + Intronic
1058086292 9:100752068-100752090 TCTCTCTCTGAGGCCATTGCTGG + Intergenic
1061473067 9:130842818-130842840 TCTGGATCTGCGGCCACTGCAGG + Intronic
1203785267 EBV:124100-124122 TCGACCCCTGCGGCCACAGCCGG + Intergenic
1186051786 X:5604341-5604363 TCGCTCTCTCCTGCCACTGTGGG - Intergenic
1195732112 X:107978546-107978568 TCTCGCTCTGCTGCCCATGCTGG - Intergenic