ID: 952978188

View in Genome Browser
Species Human (GRCh38)
Location 3:38713987-38714009
Sequence GCAGTGGCCGCAGAGCGCGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952978182_952978188 7 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978188 3:38713987-38714009 GCAGTGGCCGCAGAGCGCGAAGG 0: 1
1: 0
2: 0
3: 9
4: 99
952978183_952978188 6 Left 952978183 3:38713958-38713980 CCGCATGCCTTCAAATCGAGAAA 0: 1
1: 0
2: 1
3: 15
4: 124
Right 952978188 3:38713987-38714009 GCAGTGGCCGCAGAGCGCGAAGG 0: 1
1: 0
2: 0
3: 9
4: 99
952978184_952978188 -1 Left 952978184 3:38713965-38713987 CCTTCAAATCGAGAAAGAGCCCG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 952978188 3:38713987-38714009 GCAGTGGCCGCAGAGCGCGAAGG 0: 1
1: 0
2: 0
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952978188 Original CRISPR GCAGTGGCCGCAGAGCGCGA AGG Exonic
900184677 1:1327519-1327541 GGAGTCGGCGCAGAGCGCGGAGG - Exonic
900968160 1:5973996-5974018 GCCCTGGCTGCAGAGCCCGATGG - Intronic
901506302 1:9687973-9687995 GCAGAGGCCGCCGAGGGCGGAGG + Intronic
901647910 1:10726615-10726637 GCAGGGGCCGCACAGCGCCAGGG - Intronic
901878871 1:12182313-12182335 GCAGTGGGCCCAGAGCGGGTGGG - Intronic
903129638 1:21270355-21270377 GCAGGGGGCGCAGAGCCTGAGGG - Intronic
904753193 1:32753933-32753955 CCATTGGCCGCAGAGCTCGGGGG + Intronic
904946249 1:34200827-34200849 CCAGTGGCCCCAGAGCCAGAAGG + Exonic
905108395 1:35577321-35577343 GCAGTGACCGCGGAGGGCCAAGG - Intronic
906290630 1:44617353-44617375 GCAGCGGCCGCAGGGAGGGAGGG - Intronic
915386624 1:155500087-155500109 GCAGAGGCTGCAGAGCCCAATGG + Intronic
919820458 1:201468975-201468997 GCGGTGGGCGCGGAGCGCGCTGG - Exonic
919827248 1:201512099-201512121 GCAGTGGCTGCAGAGGGAGCAGG - Intergenic
1067430556 10:46240792-46240814 GCAGTGGCAGCAGTGGGCCAGGG - Intergenic
1073063574 10:100745852-100745874 GCGGTGGTCGGAGAGCGCGCGGG - Exonic
1076920758 10:133453584-133453606 GCAGTGGCCCCAGACAGCCAAGG - Intergenic
1079106740 11:17576852-17576874 GCAGTGGCTGCAGAGAGAGACGG - Exonic
1082838465 11:57668490-57668512 GCGGGGACCGCAGAGCCCGAGGG - Intronic
1083820184 11:65166001-65166023 GGAGAGGCCGCAGCGCACGACGG + Intergenic
1084010755 11:66347108-66347130 GCAGTGGCTGCTCAGCGCGTAGG + Exonic
1084888528 11:72225148-72225170 TCACAGGACGCAGAGCGCGAAGG - Exonic
1085077796 11:73607183-73607205 GCCGTGGCAGAAGAGAGCGAGGG + Intergenic
1088224667 11:107606545-107606567 ACATTGGCGGCAGAGCGCGGTGG + Intronic
1088485259 11:110334225-110334247 GCAGTGTCAGCCGGGCGCGATGG - Intergenic
1089139908 11:116276701-116276723 GCAGTGGCCGCAGGGGTCGGAGG - Intergenic
1091192964 11:133709377-133709399 TCCGTGGCAGCAGAGGGCGAGGG - Intergenic
1091750886 12:3020660-3020682 GCCGGGGGCGCAGAGGGCGATGG - Exonic
1096809267 12:54159309-54159331 GCAGCTGCCACAGAGCGGGAGGG + Intergenic
1096829668 12:54304464-54304486 GCAGTGGCCCCAGAGGGTGGGGG + Intronic
1099890221 12:88580676-88580698 GCACTGGCGGGAGACCGCGAAGG + Intronic
1101471209 12:104998973-104998995 GCAGTGGCTGCACAGGGCGCAGG + Intronic
1104602638 12:130163455-130163477 GCAGCGGCCCCACAGCGCGCAGG + Exonic
1105934940 13:25090012-25090034 GCAGGGGCCGCAGGGAGTGAGGG - Intergenic
1106498790 13:30307486-30307508 GCGGTGGGCGCAGCGCGGGAGGG + Intergenic
1112506981 13:99981357-99981379 GCTGTCGCCGCAGAGCGCCGCGG + Intergenic
1113484948 13:110646730-110646752 GCAGGGGGCTCAGAGCCCGAGGG + Intronic
1113493785 13:110712986-110713008 GCTGCGGCCGCAGAGTGCGCGGG - Intronic
1114267392 14:21080980-21081002 GCTGTAGCCGCAGGGCCCGATGG - Exonic
1119601942 14:75982387-75982409 GCAGGGTCCGCAGAGGGCGCGGG + Intronic
1119744339 14:77033551-77033573 ACAGTGGCCACAGCGAGCGATGG + Intergenic
1122194770 14:100076718-100076740 GCAGAGGCCACAGAGTGCGGGGG + Intronic
1124348230 15:28936672-28936694 CCAGTGTCCGCAGAGCCCCAGGG + Intronic
1132466239 16:78500-78522 GCAGTGGCCGCAGCGCCCGGGGG + Intronic
1136334210 16:29600982-29601004 GCAGTGGTCGGGGAGCGGGATGG + Intergenic
1137667457 16:50260006-50260028 GCAGAGGCAGCACAGCTCGATGG - Intronic
1142748389 17:1972517-1972539 GGAGGGGCCGCAAAGCGGGAAGG - Intronic
1143719998 17:8802816-8802838 GCAGTGGCCTGAGAGTGGGAAGG + Exonic
1143870564 17:9954898-9954920 GCAGTGGCAGCAGAGGGGCATGG + Intronic
1147986178 17:44308814-44308836 GCAGTGGCCGCACATCTGGATGG + Exonic
1148564608 17:48625631-48625653 GCGGTGGCCGGAGAGCGGGCCGG - Intronic
1149446388 17:56716585-56716607 GCAGTGGCCCCAGAGGCAGAGGG - Intergenic
1151787615 17:76282888-76282910 GCAGCCACTGCAGAGCGCGAGGG + Intronic
1152388060 17:79986902-79986924 GCAGAGACCGGAGGGCGCGAGGG - Intronic
1152391074 17:80004172-80004194 CCAGTGGCCGCAGTGCGGGACGG + Intronic
1156460340 18:37318187-37318209 GCAGTGGCCGCAGAAGGAGGGGG - Intronic
1161425297 19:4199711-4199733 GCAGGGGCCGCAGGGCGGGCAGG - Exonic
1161744161 19:6044869-6044891 GCAGTGGGGTCAGAGAGCGAGGG - Intronic
1162491298 19:10993927-10993949 GCACTGGCGGCAGGGCGCGGTGG - Intronic
1165332957 19:35151491-35151513 GCAGTGGGCAAAGAGCGGGAGGG + Intronic
926113431 2:10196698-10196720 GCAGTGACCGCACAGGGCGATGG + Intronic
936279136 2:111122610-111122632 GCGGCGGGCGCAGAGCGCGAGGG + Intronic
938115422 2:128599958-128599980 GCAGTGCCAGCAGAGGCCGAGGG + Intergenic
941102123 2:161308203-161308225 GCGGCGGCCGCAGAGCGCAGAGG + Exonic
946050204 2:216855905-216855927 CCACTGGCCTCAGAGCCCGATGG - Intergenic
948782336 2:240329506-240329528 GCAGGGGCCGCAGAGGGTGGAGG + Intergenic
948953819 2:241272381-241272403 GCCGTGGCCGCACGGCGCGGAGG - Intronic
1173154117 20:40593546-40593568 CCAGTGGCCTCAGAGAGGGAGGG - Intergenic
1175980917 20:62738159-62738181 GCAGTGCACGCAGAGGGTGATGG + Intronic
1179435451 21:41359355-41359377 GCAGGGGCAGCAGAGGGCCAAGG - Intergenic
1180220131 21:46353273-46353295 GCAGAGGCTGCAGGGGGCGAGGG + Exonic
1181884411 22:26008805-26008827 GCAGTGGAAGGAGAGCGAGAAGG - Intronic
1182487874 22:30650002-30650024 GCAGTGGGCACAGAGAGCGCTGG + Intronic
1184842444 22:47060202-47060224 GCAGGGGCCGCAGAGGCTGAAGG - Intronic
950939894 3:16883238-16883260 GCAGTCCCCGCAGGGCGCAAAGG - Intronic
952978188 3:38713987-38714009 GCAGTGGCCGCAGAGCGCGAAGG + Exonic
953027332 3:39152835-39152857 GCAGTGGCCTCTGAGAGTGACGG + Intronic
961563377 3:127746671-127746693 GGAGTGGACGCAGAGGGAGACGG - Intronic
961735832 3:129001709-129001731 GCAGTGGCTGCTGAGCGCCCTGG + Exonic
966860691 3:184229772-184229794 GCAGTGGCCGCGGCCCGCGCAGG - Intronic
968517165 4:1020262-1020284 GCAGTGGCTGCAGTGCGGGATGG + Intronic
972671018 4:41214246-41214268 GCAGTGGCCGCGGAGCCCCGGGG + Intronic
975401505 4:73944285-73944307 GCAGTAGCCGGGGAGCGCGGGGG + Intergenic
982464665 4:155715471-155715493 GCAGTGGCTACAGAGCTAGAGGG + Intronic
985645713 5:1083848-1083870 GAAGAGGCCCCAGAGCGCGGAGG + Exonic
985791472 5:1930778-1930800 GCAGTGGCCCCGGAGCGTGGAGG + Intergenic
985996572 5:3600361-3600383 GCAGTGGCCGCTGAGCCCTGGGG + Intronic
991400393 5:66245463-66245485 GCAGTGGCTGCAGTGAGGGATGG + Intergenic
991728446 5:69560139-69560161 GGCGTGGCCGCAGGGCGCGGCGG + Intergenic
991804875 5:70415286-70415308 GGCGTGGCCGCAGGGCGCGGCGG + Intergenic
991866509 5:71067736-71067758 GGCGTGGCCGCAGGGCGCGGCGG - Intergenic
992833139 5:80614976-80614998 GCACTGGCCTCAGAGAGAGAAGG - Intergenic
999148220 5:149409717-149409739 GCAGTGGCCTCAGAGCTAGAAGG - Intergenic
1003580052 6:7331773-7331795 GCAGTGGCAGCAGAGGTTGAAGG + Intronic
1006033922 6:31197507-31197529 GCAGTGACAGCCGAGCGCGGTGG - Intergenic
1019607783 7:1918757-1918779 GCAGTGGCCTCAGAGCACAGTGG - Intronic
1039493677 8:37965688-37965710 GCCGGGGCCAGAGAGCGCGACGG + Exonic
1039922826 8:41905292-41905314 GCAGTGGCCGTGGAGCGAGAGGG - Intergenic
1044475384 8:92619186-92619208 TCAGTGGCGGCAGAGTGGGAAGG + Intergenic
1049283744 8:141763451-141763473 GCAATGGCCAAAGAGCGTGAGGG - Intergenic
1050325031 9:4490416-4490438 CCAGGCGCCGCAGAGCGCGGCGG + Intergenic
1052903824 9:33817298-33817320 GCAGGGGCCGGAGGGCGCGCGGG - Intergenic
1056237106 9:84605741-84605763 GCAGTGGTGGCAAAGCGGGAAGG - Intergenic
1060975524 9:127762687-127762709 GCAGTGGACACGGAGCCCGAGGG - Intronic
1062484097 9:136765630-136765652 GCAGAGGCTGCAGAGAGCCAAGG - Intronic
1185494731 X:545657-545679 GCAGGGGTCCCCGAGCGCGACGG + Intergenic
1187226363 X:17377524-17377546 GCAGTGGCCTAGGAGCGCGCGGG + Intronic
1189262223 X:39687134-39687156 GCAGTGGGGGCAGAGCGGCAGGG + Intergenic
1190301303 X:49059110-49059132 GCAGTGGGCCCAGGGTGCGAGGG + Intronic
1198533791 X:137567803-137567825 GCAGCGGACTTAGAGCGCGAGGG + Intronic