ID: 952978189

View in Genome Browser
Species Human (GRCh38)
Location 3:38713988-38714010
Sequence CAGTGGCCGCAGAGCGCGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952978184_952978189 0 Left 952978184 3:38713965-38713987 CCTTCAAATCGAGAAAGAGCCCG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 952978189 3:38713988-38714010 CAGTGGCCGCAGAGCGCGAAGGG 0: 1
1: 0
2: 0
3: 1
4: 62
952978182_952978189 8 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978189 3:38713988-38714010 CAGTGGCCGCAGAGCGCGAAGGG 0: 1
1: 0
2: 0
3: 1
4: 62
952978183_952978189 7 Left 952978183 3:38713958-38713980 CCGCATGCCTTCAAATCGAGAAA 0: 1
1: 0
2: 1
3: 15
4: 124
Right 952978189 3:38713988-38714010 CAGTGGCCGCAGAGCGCGAAGGG 0: 1
1: 0
2: 0
3: 1
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952978189 Original CRISPR CAGTGGCCGCAGAGCGCGAA GGG Exonic
901506303 1:9687974-9687996 CAGAGGCCGCCGAGGGCGGAGGG + Intronic
902385606 1:16073735-16073757 CTGTGGCCGCAGCGCGCGGGAGG + Intergenic
904130763 1:28273679-28273701 CAGTGGTCGCACAGCCGGAAAGG - Intronic
915631771 1:157158106-157158128 CTGTGGCTGCAGAGAGGGAAGGG + Intergenic
1070162401 10:73874199-73874221 CAGTTGCTGCAGGGCGCGGAGGG + Intronic
1075388984 10:122078571-122078593 CAGTGCCCCCAGAGGGTGAAAGG + Intronic
1079106739 11:17576851-17576873 CAGTGGCTGCAGAGAGAGACGGG - Exonic
1079688999 11:23399383-23399405 CAGTGGTGGCAGAGTGAGAATGG + Intergenic
1091699099 12:2648363-2648385 CAGTGGCAGAAGAGGGCAAAAGG - Intronic
1092189658 12:6509729-6509751 CAGGGGCCCCTGAGCTCGAAAGG - Exonic
1101471210 12:104998974-104998996 CAGTGGCTGCACAGGGCGCAGGG + Intronic
1101884232 12:108648045-108648067 CAGTGGCCGCAGCGAGTCAAAGG + Intronic
1101897512 12:108767637-108767659 CAGTGGCCTCAGAGAGCTGATGG + Intergenic
1103915629 12:124374272-124374294 CAGAGGCCGCGGAGCACAAACGG + Intronic
1113378980 13:109786248-109786270 CAGGAGCCCCAGAGCGCGGAGGG - Exonic
1123418254 15:20108095-20108117 CAGGGGCCCCAGAGAGCGAGAGG + Intergenic
1123527472 15:21114617-21114639 CAGGGGCCCCAGAGAGCGAGAGG + Intergenic
1142272702 16:89099009-89099031 CAGTGGCAGCAGAGCCCAGAGGG + Intronic
1142748388 17:1972516-1972538 GAGGGGCCGCAAAGCGGGAAGGG - Intronic
1143719999 17:8802817-8802839 CAGTGGCCTGAGAGTGGGAAGGG + Exonic
1152381273 17:79943470-79943492 CAGTGACCCCTGAGCGAGAAAGG - Intronic
1153436117 18:5069575-5069597 CAGTGTCCCCAGAGCAGGAATGG - Intergenic
1154302598 18:13207402-13207424 CTGAGGCAGCAGAGCGGGAATGG + Intergenic
1160591761 18:79948926-79948948 CAGTGGCCTCAGTGAGCGTAAGG - Intronic
1160719572 19:591254-591276 CTGTGGCCGGAGAGCGAGACCGG + Intronic
1161772055 19:6236242-6236264 CAGTGTCTGCAGAGCGCTGATGG + Intronic
1163268446 19:16235052-16235074 CAGTGGCCCCCGAGCGCGCCAGG - Exonic
926113432 2:10196699-10196721 CAGTGACCGCACAGGGCGATGGG + Intronic
927062067 2:19432621-19432643 CAGTAGCCCCAGAGCGAGGAGGG + Intergenic
936279137 2:111122611-111122633 CGGCGGGCGCAGAGCGCGAGGGG + Intronic
946050203 2:216855904-216855926 CACTGGCCTCAGAGCCCGATGGG - Intergenic
948953817 2:241272380-241272402 CCGTGGCCGCACGGCGCGGAGGG - Intronic
1173436377 20:43035398-43035420 CAGTTGCCGCAGAGACCGTATGG - Intronic
1178485665 21:33018900-33018922 CTCTGGGCGCAGAGCGCCAAAGG + Intergenic
1179435450 21:41359354-41359376 CAGGGGCAGCAGAGGGCCAAGGG - Intergenic
1179585473 21:42371403-42371425 CAGTGGCCGGAGAGTGTGAGTGG - Intergenic
1184039694 22:41935503-41935525 CAGTAGCAGCAGAGCCCGGAAGG - Intergenic
1184842443 22:47060201-47060223 CAGGGGCCGCAGAGGCTGAAGGG - Intronic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
952978189 3:38713988-38714010 CAGTGGCCGCAGAGCGCGAAGGG + Exonic
954378262 3:50205963-50205985 CAGCGGGCGCAGGGCGCGAGTGG + Intronic
960084694 3:113578053-113578075 CAGTGGCAGGAGAGGGCCAAAGG + Intronic
966860690 3:184229771-184229793 CAGTGGCCGCGGCCCGCGCAGGG - Intronic
967355735 3:188568871-188568893 CAGTGGCTGCAGGGCCTGAAGGG + Intronic
969297637 4:6279149-6279171 CAGTGGCCGCAGGGAGGGCAGGG + Intronic
972563147 4:40246352-40246374 CGGTGGCAGCAGAGCAGGAAGGG + Exonic
979455543 4:120922515-120922537 CACGGCCCGCAGAGTGCGAAAGG - Exonic
985544920 5:504698-504720 CAGTGGCCTCACAGCGCTGAGGG - Intronic
985791473 5:1930779-1930801 CAGTGGCCCCGGAGCGTGGAGGG + Intergenic
992089323 5:73303501-73303523 CAGTGCCCGCAGCCCGCGAGTGG + Intergenic
995631416 5:114137135-114137157 CAGTGGCAGCAGGGAGCGTAGGG - Intergenic
1001711975 5:173786373-173786395 CAGTGGCAGCAGAAGGCCAAGGG - Intergenic
1011888783 6:92130335-92130357 CAGTGGCAGGAGAGTGGGAAAGG - Intergenic
1019197732 6:170291753-170291775 CAGTGGCCGCGGACCACGAGAGG - Intergenic
1019313347 7:373485-373507 CACTGGTCGCAGAGCACAAAAGG - Intergenic
1029276575 7:99408657-99408679 CAGTGGCCGCAGTGGCCGCAAGG + Exonic
1033664101 7:143424610-143424632 CAGCGGCTGCAGAGCGTGTACGG - Intergenic
1038217658 8:25577512-25577534 AAGTGGGCACAGAGCGAGAAGGG - Intergenic
1039922825 8:41905291-41905313 CAGTGGCCGTGGAGCGAGAGGGG - Intergenic
1040372118 8:46787636-46787658 CAGTGGCAGCAGAGTGCTAGTGG + Intergenic
1044475385 8:92619187-92619209 CAGTGGCGGCAGAGTGGGAAGGG + Intergenic
1061287390 9:129631830-129631852 CAGTGCCAGCAGAGCACGGAGGG - Intronic
1190685290 X:52867893-52867915 CCGTGGCCTCAGAGGCCGAAGGG - Intronic
1195544511 X:106100257-106100279 CAGTGGCCGCTTAGGGCTAAAGG + Intergenic