ID: 952978192

View in Genome Browser
Species Human (GRCh38)
Location 3:38713997-38714019
Sequence CAGAGCGCGAAGGGTTCGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 23}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952978186_952978192 -10 Left 952978186 3:38713984-38714006 CCCGCAGTGGCCGCAGAGCGCGA 0: 1
1: 0
2: 0
3: 10
4: 144
Right 952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 23
952978184_952978192 9 Left 952978184 3:38713965-38713987 CCTTCAAATCGAGAAAGAGCCCG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 23
952978182_952978192 17 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 23
952978183_952978192 16 Left 952978183 3:38713958-38713980 CCGCATGCCTTCAAATCGAGAAA 0: 1
1: 0
2: 1
3: 15
4: 124
Right 952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952978192 Original CRISPR CAGAGCGCGAAGGGTTCGAA GGG Exonic
913189739 1:116403336-116403358 CTGAGCCCGAAGGCTTCCAAGGG - Intronic
1069853082 10:71423189-71423211 CAGTGCATGGAGGGTTCGAACGG + Intronic
1076075649 10:127531853-127531875 CAGAGAGCAAAAGGTTAGAATGG - Intergenic
1077252297 11:1566049-1566071 CAGAGGGAGAAGGGTTCCCACGG - Intronic
1078334013 11:10450200-10450222 CAGAGCGAGGAGGGTTGGAGAGG + Intronic
1096995600 12:55836089-55836111 CAGAGGGGGAAGAGTTAGAATGG - Intronic
1121821388 14:96970695-96970717 CAGAGCCCAAAGGGTTCAACAGG - Intergenic
1129923941 15:79345294-79345316 CAGAGGGTGAAGGGTGGGAAGGG - Intronic
1130224677 15:82047412-82047434 CAGAGCGCGCGGGGCCCGAAGGG - Intergenic
1152649313 17:81484581-81484603 CAGGGCGCGAAGGGGTCCCAAGG - Intergenic
1163084982 19:14972976-14972998 CAGATGGCGAAGGCTGCGAAGGG + Intronic
1163679060 19:18670129-18670151 CAGGGCGCGGAGGGGTGGAAAGG - Exonic
929596809 2:43181167-43181189 CAGAGAGTGAAGGGTGCGATGGG + Intergenic
933484274 2:82897590-82897612 CAGAGCGCTAAGGGGTAGCATGG + Intergenic
1173441981 20:43085884-43085906 CAGAGCGCTAAGGATCCTAAGGG + Intronic
1175076458 20:56378866-56378888 CAGAGATGGAAGGGTTGGAAGGG + Intronic
952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG + Exonic
955811442 3:62794961-62794983 CAGAGCGCTATGGGTTCTCAGGG + Intronic
969311254 4:6354085-6354107 CAGAGCGCAAGGGGTTCAGATGG - Intronic
1004039421 6:11961068-11961090 CAGAGGGTGCAGGGTTAGAAAGG - Intergenic
1054748346 9:68878895-68878917 CAGGGGGTGAAGGGTTGGAAGGG + Intronic
1188652722 X:32651903-32651925 CAGAAGGCGCAGAGTTCGAATGG - Intronic
1189193000 X:39127239-39127261 AAGGGCGGGAAGGGTTTGAAAGG + Intergenic
1191110837 X:56802337-56802359 CAGAGGGCCAAGGGTCCCAAGGG - Intergenic