ID: 952978193

View in Genome Browser
Species Human (GRCh38)
Location 3:38714006-38714028
Sequence AAGGGTTCGAAGGGCTTTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952978186_952978193 -1 Left 952978186 3:38713984-38714006 CCCGCAGTGGCCGCAGAGCGCGA 0: 1
1: 0
2: 0
3: 10
4: 144
Right 952978193 3:38714006-38714028 AAGGGTTCGAAGGGCTTTGATGG 0: 1
1: 0
2: 0
3: 12
4: 114
952978184_952978193 18 Left 952978184 3:38713965-38713987 CCTTCAAATCGAGAAAGAGCCCG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 952978193 3:38714006-38714028 AAGGGTTCGAAGGGCTTTGATGG 0: 1
1: 0
2: 0
3: 12
4: 114
952978182_952978193 26 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978193 3:38714006-38714028 AAGGGTTCGAAGGGCTTTGATGG 0: 1
1: 0
2: 0
3: 12
4: 114
952978183_952978193 25 Left 952978183 3:38713958-38713980 CCGCATGCCTTCAAATCGAGAAA 0: 1
1: 0
2: 1
3: 15
4: 124
Right 952978193 3:38714006-38714028 AAGGGTTCGAAGGGCTTTGATGG 0: 1
1: 0
2: 0
3: 12
4: 114
952978187_952978193 -2 Left 952978187 3:38713985-38714007 CCGCAGTGGCCGCAGAGCGCGAA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 952978193 3:38714006-38714028 AAGGGTTCGAAGGGCTTTGATGG 0: 1
1: 0
2: 0
3: 12
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952978193 Original CRISPR AAGGGTTCGAAGGGCTTTGA TGG Exonic
908042253 1:60127249-60127271 AAGGGTGGGATGGCCTTTGAAGG + Intergenic
908566270 1:65359572-65359594 AAGGGTCCTCAGGGATTTGAGGG - Intronic
910043948 1:82889142-82889164 AAGGGTTCCCAGTGCTTTCAGGG + Intergenic
911232799 1:95378500-95378522 AAGGGTTGGGAGGGCAGTGAAGG + Intergenic
912619460 1:111140339-111140361 AAGGATTTGAAGGGCGTTGTAGG + Intronic
915789103 1:158648475-158648497 AAGTGTTGGAAAAGCTTTGAAGG + Intronic
918296632 1:183163100-183163122 ATGGGTTAGGAGGGCTATGATGG + Intergenic
918492390 1:185095167-185095189 AAGCGTTGGAAGGACTTTAATGG + Intronic
920126888 1:203700517-203700539 AAGTGTTATAAGGGCCTTGAAGG + Intronic
920569018 1:207002243-207002265 AAGAGTTCTCAGGGCTTTGATGG + Intergenic
922142721 1:222906297-222906319 AAGAGTTCGATGTGCTTTGGGGG + Intronic
924111292 1:240702468-240702490 AAGGGATCTAGGGGCTTTGAAGG + Intergenic
924845620 1:247767177-247767199 AAGGGTGGGAAGGGGGTTGAGGG - Intergenic
1064136389 10:12754305-12754327 CAGGGTGTGAATGGCTTTGAGGG - Intronic
1072728852 10:97831300-97831322 AGGGGTGTGAAGGCCTTTGAGGG - Intergenic
1074697931 10:116067511-116067533 AAGAGTTCCAAGGGCTGGGAAGG + Intronic
1075301585 10:121329279-121329301 AAGGGTTCAAAGTGCTTTATTGG + Intergenic
1083748291 11:64746881-64746903 AGGGGTTGGCAGGGCTTTGGTGG - Intronic
1087389256 11:97513545-97513567 CAGGGTTCCAAGTGATTTGAGGG + Intergenic
1088383714 11:109225486-109225508 AAATATTTGAAGGGCTTTGAAGG - Intergenic
1092261196 12:6954105-6954127 CAGGGTTCAAACGGATTTGAAGG - Intronic
1095245788 12:39919645-39919667 AAAGGTTCAAAGGGCTTGGATGG + Intronic
1100334690 12:93618400-93618422 AAGTCTTCGAAGGGCTTGGGTGG - Intergenic
1106486330 13:30176115-30176137 AAGGATTTGTAGGTCTTTGATGG + Intergenic
1106531368 13:30595675-30595697 GAGGGCTCTGAGGGCTTTGAGGG + Intronic
1108494095 13:51007374-51007396 CAGGGTTGGGAGGGTTTTGATGG - Intergenic
1112143198 13:96669419-96669441 AAGTGTTCGAAGCACTTGGAGGG + Intronic
1113262031 13:108575521-108575543 AAAGGTTCAAAGGGCTTTTGTGG - Intergenic
1117096500 14:52303936-52303958 ATGAGTTTGAAGGGCTTTGAGGG - Intergenic
1121253519 14:92515874-92515896 TTGGGTTGGAAGGACTTTGAAGG + Intronic
1202833735 14_GL000009v2_random:62621-62643 AAGGATTGGAAGGGTTTGGAGGG + Intergenic
1125058937 15:35395636-35395658 AAGGGTTAGAACTGATTTGAAGG - Intronic
1125313910 15:38410632-38410654 AAGTCATGGAAGGGCTTTGAAGG + Intergenic
1128800980 15:70496817-70496839 TAAGGGTGGAAGGGCTTTGAAGG - Intergenic
1130244903 15:82237987-82238009 AAGGGTTAAAAAGGGTTTGAGGG + Intronic
1130910119 15:88265062-88265084 AAGTGTCCGCAGTGCTTTGAGGG - Intergenic
1135182238 16:20285793-20285815 AAGAGTTCCAAGGGTTTTAAAGG - Intergenic
1136238854 16:28932210-28932232 AAGGGTTGGAAGGACTCTGCCGG + Intronic
1139691984 16:68646792-68646814 AAGGGTTCTCAGTGTTTTGAAGG - Intronic
1139925176 16:70481978-70482000 GAGGGTTGGAAGGGCTTTCAGGG + Intronic
1151025875 17:70676103-70676125 AAGGATTCAAAGGGCTTTAAAGG + Intergenic
1153442636 18:5137537-5137559 CAGGGAACCAAGGGCTTTGAAGG + Intergenic
1160262098 18:77303651-77303673 AAGGGTGGGAAGGGCTTGCAGGG + Intergenic
1160481475 18:79244457-79244479 AAGAGTTCAAAGCTCTTTGAAGG + Intronic
1162655615 19:12126945-12126967 AATGGTTCAAAGGACTTTGTTGG + Intronic
1164759196 19:30715947-30715969 AAGGCTTCAGAGGGCTGTGATGG - Intergenic
1168714841 19:58520656-58520678 AAGGGTTCCAGAGGCTTTGAAGG + Intronic
925052008 2:823001-823023 AAGGGTACGAAGAGCATTGCTGG - Intergenic
925920537 2:8634758-8634780 AAGTGTTCGCCTGGCTTTGACGG - Intergenic
928165115 2:28965560-28965582 AAGGGTTCCCAGGGCTTACACGG - Intronic
930487842 2:52030627-52030649 AATGGTTTGAAGGTCTTAGATGG - Intergenic
930901979 2:56518438-56518460 GAGGGTTAGAAGCACTTTGAAGG - Intergenic
932703802 2:74008341-74008363 AGGGGCTCCAAGGGCTCTGACGG - Intronic
932790848 2:74653600-74653622 TAGGGTTGGTAGGCCTTTGAGGG - Intergenic
933750195 2:85598378-85598400 AAGGGTTTCAAGCCCTTTGAAGG + Intergenic
934554186 2:95278731-95278753 CAGGGCTGGAAGGGCGTTGAAGG - Exonic
935585759 2:104798644-104798666 AAGGGCTGGAAAGGCTTTGAAGG - Intergenic
936527381 2:113250813-113250835 AAAGGTTCGAAGTTCCTTGAAGG - Intronic
936982106 2:118274494-118274516 AAGGGTGAAAAGGGCTTTCAAGG - Intergenic
937225882 2:120368474-120368496 AAGGGCCCGGAGGGCTTTCAGGG + Intergenic
947888422 2:233594685-233594707 AAGGGTTTGGAGGGCTCAGAAGG + Intergenic
1169800951 20:9510905-9510927 AGGGTTGCGAAGGTCTTTGAAGG + Intergenic
1171006269 20:21468271-21468293 CAAGATTCGAAGGTCTTTGAGGG + Intergenic
1171885536 20:30649198-30649220 AAAGATTGGAAGGGCTTGGAGGG - Intergenic
1172143848 20:32743057-32743079 AGGGGTCCGAAAGGCTTTGTGGG - Intronic
1172276785 20:33684434-33684456 AAGGGCAAGAAGGGCTTTTAGGG - Intronic
1177079565 21:16621643-16621665 AAGGGTTAGAAGGGTTTCAATGG - Intergenic
1177316594 21:19470356-19470378 AAGTATTCTAAGGGCTTTGAGGG + Intergenic
1179441704 21:41399436-41399458 AAGGGTTCCACGGTCTTGGATGG - Intronic
1181487826 22:23242660-23242682 GAGGGCTGGAAGGGCTTTGGAGG - Intronic
1182749437 22:32629735-32629757 CAGGATTCAAAGAGCTTTGAAGG - Intronic
1184847802 22:47099900-47099922 CAGGGCTGGAAGGGCTCTGAAGG - Intronic
951041283 3:17991291-17991313 AATGGTTTGAGGGGCTGTGAGGG + Intronic
951984157 3:28599612-28599634 AAGTGTTTGAAGGGATGTGAAGG + Intergenic
952978193 3:38714006-38714028 AAGGGTTCGAAGGGCTTTGATGG + Exonic
954153794 3:48673690-48673712 CAGGGCTCAAAGGGCCTTGAAGG + Intergenic
954972285 3:54661276-54661298 AAAGTTTCCATGGGCTTTGAGGG - Intronic
956074168 3:65487242-65487264 AAGTGTGCGAAGGTCTTTAAAGG - Intronic
956929173 3:74023167-74023189 ATGGGTGCAAAGTGCTTTGAAGG - Intergenic
957607840 3:82427326-82427348 AAGGGTCAGAAGAGCTTTAATGG - Intergenic
960455469 3:117865917-117865939 CAGGGTTTGAAGAGCTTTAAAGG - Intergenic
961581808 3:127889356-127889378 AAGGGTTAGAAGAGATTTAATGG - Intergenic
962927261 3:140006471-140006493 AGAGGTTCCAAGGGATTTGAAGG - Intronic
964593288 3:158391540-158391562 AAGGGAGCCAAGGGCTTTAAGGG - Intronic
965011382 3:163096628-163096650 CAGGGTTCCTAGGGATTTGAGGG - Intergenic
969326650 4:6448176-6448198 AACGATGCAAAGGGCTTTGACGG - Intronic
973369182 4:49231451-49231473 AAAGATTGGAAGGGCTTGGAGGG - Intergenic
973391856 4:49563965-49563987 AAAGATTGGAAGGGCTTGGAGGG + Intergenic
973612859 4:52653562-52653584 AAGGGTTTGAAAGGCCTTGGTGG - Intronic
974594066 4:63994686-63994708 CAGGGTTCCAAGTGGTTTGAAGG + Intergenic
976830476 4:89308464-89308486 ATGGGCTTGGAGGGCTTTGAGGG + Intergenic
976836032 4:89374935-89374957 AAGGCTTTGGAGGGTTTTGAGGG + Intergenic
978931598 4:114320567-114320589 AATGTTTCGAAGGGATATGAGGG - Intergenic
979268210 4:118728132-118728154 AAAGGCTAGAAGGGCTTGGAAGG + Intronic
982194260 4:152894272-152894294 AAGGTTTGGAAAAGCTTTGAGGG + Intronic
988085955 5:26476029-26476051 AAGGTTTTGAAAGGCTGTGAGGG + Intergenic
998773488 5:145572627-145572649 CAGGGTGCCAAAGGCTTTGATGG - Intronic
1000976308 5:167768501-167768523 AAAGCTTCTAAGGGCTTTGGAGG - Intronic
1001854364 5:174998139-174998161 AAGGGTTCAAAGGGTTTTTCAGG + Intergenic
1002209180 5:177585837-177585859 AAGGGTGCGAAGGGGGTTGAGGG - Intergenic
1007019713 6:38507191-38507213 AAGAATTAGAAGGGCTCTGAAGG - Intronic
1007712763 6:43835107-43835129 AAGGGTTGGGGGGGCCTTGATGG - Intergenic
1014212883 6:118725010-118725032 AAGGTTTCTGAGGGCTTTTAAGG + Intergenic
1014675087 6:124354058-124354080 CGGGGTTGGAAGGGCTTTCATGG - Intronic
1015496471 6:133889009-133889031 AAGGGGTCTAAGCGCTTTGCTGG + Intergenic
1022366908 7:29730412-29730434 AAGGGTGGGAAGGACTTTGGTGG - Intergenic
1024296063 7:47843308-47843330 CTGAGTTAGAAGGGCTTTGAAGG + Intronic
1025605843 7:63039326-63039348 AAGGGTTCACAGGACTTGGAGGG - Intergenic
1033023763 7:137753426-137753448 GAGGGTTCCAAGGCCTTTCAGGG + Intronic
1034873646 7:154705933-154705955 AAGGGTTGGAAGGCCTGTGAAGG + Intronic
1036513698 8:9423677-9423699 AAGAGCTGGAAGGACTTTGAGGG + Intergenic
1038086480 8:24203105-24203127 AAGTTTTTGAAGAGCTTTGAGGG + Intergenic
1041595946 8:59653179-59653201 AATGGGTAGAAGGGCTCTGAAGG + Intergenic
1048174290 8:132137830-132137852 TAAGGTTCATAGGGCTTTGAGGG + Intronic
1050562452 9:6848225-6848247 AAAGGTTGGAATGGCTTTAAAGG + Intronic
1053286024 9:36850055-36850077 AAGGGTGGGTAGGACTTTGATGG + Intronic
1056070529 9:82982144-82982166 AAGGGCTGCAAGGCCTTTGAGGG + Exonic
1057505896 9:95633123-95633145 AAGGGTTAGAATGGATTTGAGGG - Intergenic
1060347150 9:122827419-122827441 AAGGGTTTAAAGGACTATGATGG + Intronic
1188185012 X:27103045-27103067 AAGTTTTAGTAGGGCTTTGAAGG - Intergenic
1192071831 X:67948823-67948845 AAAGGTTGGAAGGGTTATGAGGG - Intergenic
1192205574 X:69093836-69093858 AAGGGTTTGAGGAGCTTGGAAGG + Intergenic
1192357518 X:70418098-70418120 AAGGGTTGGAAGAGCTGTGCAGG - Intronic
1195618744 X:106932868-106932890 AAATGTGCAAAGGGCTTTGAGGG + Intronic
1195736542 X:108018191-108018213 AATGCTTAGGAGGGCTTTGAGGG + Intergenic
1199370022 X:147036401-147036423 AGAGGTTGGAAGGGTTTTGAGGG - Intergenic
1201293016 Y:12440319-12440341 AAGGGTGGGAAGGGATGTGATGG - Intergenic