ID: 952978194

View in Genome Browser
Species Human (GRCh38)
Location 3:38714007-38714029
Sequence AGGGTTCGAAGGGCTTTGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 80}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952978190_952978194 -10 Left 952978190 3:38713994-38714016 CCGCAGAGCGCGAAGGGTTCGAA 0: 1
1: 0
2: 0
3: 0
4: 30
Right 952978194 3:38714007-38714029 AGGGTTCGAAGGGCTTTGATGGG 0: 1
1: 0
2: 1
3: 4
4: 80
952978184_952978194 19 Left 952978184 3:38713965-38713987 CCTTCAAATCGAGAAAGAGCCCG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 952978194 3:38714007-38714029 AGGGTTCGAAGGGCTTTGATGGG 0: 1
1: 0
2: 1
3: 4
4: 80
952978182_952978194 27 Left 952978182 3:38713957-38713979 CCCGCATGCCTTCAAATCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 952978194 3:38714007-38714029 AGGGTTCGAAGGGCTTTGATGGG 0: 1
1: 0
2: 1
3: 4
4: 80
952978187_952978194 -1 Left 952978187 3:38713985-38714007 CCGCAGTGGCCGCAGAGCGCGAA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 952978194 3:38714007-38714029 AGGGTTCGAAGGGCTTTGATGGG 0: 1
1: 0
2: 1
3: 4
4: 80
952978186_952978194 0 Left 952978186 3:38713984-38714006 CCCGCAGTGGCCGCAGAGCGCGA 0: 1
1: 0
2: 0
3: 10
4: 144
Right 952978194 3:38714007-38714029 AGGGTTCGAAGGGCTTTGATGGG 0: 1
1: 0
2: 1
3: 4
4: 80
952978183_952978194 26 Left 952978183 3:38713958-38713980 CCGCATGCCTTCAAATCGAGAAA 0: 1
1: 0
2: 1
3: 15
4: 124
Right 952978194 3:38714007-38714029 AGGGTTCGAAGGGCTTTGATGGG 0: 1
1: 0
2: 1
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952978194 Original CRISPR AGGGTTCGAAGGGCTTTGAT GGG Exonic
912398030 1:109363786-109363808 TGGGTTCAATGGGCTTTTATCGG + Intronic
914921697 1:151851899-151851921 TGGGGTCCAAGGGCTTTCATGGG + Intronic
918404306 1:184196265-184196287 AGTATGTGAAGGGCTTTGATAGG + Intergenic
918447024 1:184626523-184626545 AGGGTTCCCGGGGCTTTGCTGGG + Exonic
922931112 1:229390455-229390477 AGGGTTTGAAGGGCTCGAATTGG - Intergenic
923520686 1:234732979-234733001 AGGGCTCAAAGAGCTGTGATGGG + Intergenic
1062918727 10:1263596-1263618 AGTGTTTGAACAGCTTTGATTGG + Intronic
1064331166 10:14395564-14395586 AAGGTTATAATGGCTTTGATAGG - Intronic
1072048163 10:91677925-91677947 AGAGTTCCAAGGCCTTTTATAGG + Intergenic
1072987421 10:100153445-100153467 AGGGTCTGAGGGGCTTTGAAAGG - Intronic
1074975165 10:118574423-118574445 AGGGTTTGAAAGGCTGTGCTTGG - Intergenic
1075096403 10:119474342-119474364 AGGGGATGAAGGGCTTTGAGAGG - Intergenic
1080640966 11:34158055-34158077 AGGGTTCTAAGTGCTTTGCTTGG - Intronic
1081300026 11:41439809-41439831 AGGGTTTTGATGGCTTTGATGGG + Intronic
1082967631 11:58983893-58983915 AAGGCTTGAATGGCTTTGATTGG - Intronic
1088925445 11:114296585-114296607 AGGGTTAAAATGGCTTAGATAGG - Exonic
1089786447 11:120910771-120910793 AGGGTGAGAAGGACTATGATGGG + Intronic
1092261195 12:6954104-6954126 AGGGTTCAAACGGATTTGAAGGG - Intronic
1096203475 12:49703218-49703240 AGGGCTCTAAGGTCTTTGAAAGG - Intronic
1100308930 12:93377048-93377070 AGTGTTAGAAGGGCTAAGATAGG - Intergenic
1100334689 12:93618399-93618421 AGTCTTCGAAGGGCTTGGGTGGG - Intergenic
1106486331 13:30176116-30176138 AGGATTTGTAGGTCTTTGATGGG + Intergenic
1106687583 13:32077365-32077387 AGGTCTCCAAGGGCTTGGATAGG + Intronic
1108302027 13:49088017-49088039 AGTTTTCTAAAGGCTTTGATTGG + Intronic
1108494094 13:51007373-51007395 AGGGTTGGGAGGGTTTTGATGGG - Intergenic
1110704833 13:78593874-78593896 AGGGTTGGAACGGTTTTGAAAGG - Intergenic
1113262030 13:108575520-108575542 AAGGTTCAAAGGGCTTTTGTGGG - Intergenic
1121253520 14:92515875-92515897 TGGGTTGGAAGGACTTTGAAGGG + Intronic
1124657904 15:31523654-31523676 AGGGTTCACAGGGCTGTGGTGGG - Intronic
1127826465 15:62708408-62708430 AGAGCAGGAAGGGCTTTGATGGG + Intronic
1133831423 16:9326837-9326859 GGGGTTGCAAGGGCTCTGATAGG + Intergenic
1137465102 16:48700500-48700522 AGGGTAGGGAGGGCTTTGAAAGG + Intergenic
1150284427 17:63947094-63947116 AGTGTCCGCAGGGATTTGATGGG + Exonic
1150463529 17:65372502-65372524 AGGGTTAGAAGGGACTTGAAAGG + Intergenic
1150844819 17:68644968-68644990 AGGGTTCCAAGGTCTTTGTCTGG + Intergenic
1158875308 18:61728564-61728586 AGGGATGGAAGGGGTTTGAGAGG + Intergenic
1161520044 19:4718766-4718788 ACGGTGTGAAGGGCTATGATTGG - Intronic
1161544784 19:4873820-4873842 AGGGTTATCAGGGCTGTGATAGG + Intergenic
1163497605 19:17655814-17655836 AGGGTCAGCAGGGCTATGATGGG - Intronic
1167078750 19:47264973-47264995 GGGGCTCTCAGGGCTTTGATGGG + Intronic
937082980 2:119153631-119153653 AGGGTTCTCAGGCCTTTGAGAGG - Intergenic
937166738 2:119825794-119825816 AAGGGTCAAAGGGCTTGGATTGG - Intronic
940849261 2:158672687-158672709 AAGGTTAGAAAGGCTTTGAGTGG + Intronic
941498153 2:166233389-166233411 AGTGTCCGAAGGGATTTAATGGG + Exonic
947718043 2:232351625-232351647 TGGGTTGGGAGGGCCTTGATGGG + Intergenic
947741507 2:232486971-232486993 AGGGTTGGGAGGGCTCTTATTGG + Intronic
1175924494 20:62465250-62465272 AGGCTCCGAGGGGCTCTGATGGG + Intronic
1177079564 21:16621642-16621664 AGGGTTAGAAGGGTTTCAATGGG - Intergenic
1181487825 22:23242659-23242681 AGGGCTGGAAGGGCTTTGGAGGG - Intronic
1182022233 22:27090805-27090827 AGGGTTGCAAGAGCTCTGATGGG + Intergenic
950753507 3:15151866-15151888 AGGGAGAGAAGGGTTTTGATGGG - Intergenic
952978194 3:38714007-38714029 AGGGTTCGAAGGGCTTTGATGGG + Exonic
953660276 3:44886938-44886960 AGGGTTGGAAGGGCTTCCCTGGG + Intronic
954697156 3:52433913-52433935 AGGCTTCTCAGGGCGTTGATAGG + Exonic
958879823 3:99657291-99657313 AGTGTACTAAGGGCTTTCATGGG + Intronic
977749134 4:100587597-100587619 AAGGTACCAAGGGCTTAGATTGG - Intronic
986147262 5:5090136-5090158 AGGTTTCCAAGTGCTGTGATAGG + Intergenic
993656991 5:90590256-90590278 AGGGTTTGAAGGACTTAGCTGGG + Intronic
995681562 5:114726359-114726381 AGGGTTGGAATGTCTCTGATGGG - Intergenic
999149678 5:149418424-149418446 AGGGTTCCAGGGGCTTCGCTGGG - Intergenic
1001929400 5:175662107-175662129 AGGGTCCTCAGGGCTTTGATAGG + Intronic
1013137096 6:107293100-107293122 AGAGTACGGAGGGCTTTCATTGG - Intronic
1013294516 6:108746866-108746888 AAGGTTGGAAGGGCAGTGATGGG - Intergenic
1013533965 6:111046670-111046692 AGGCTTTAAAGGGCTTGGATGGG + Intergenic
1014675086 6:124354057-124354079 GGGGTTGGAAGGGCTTTCATGGG - Intronic
1015496472 6:133889010-133889032 AGGGGTCTAAGCGCTTTGCTGGG + Intergenic
1020896356 7:13945004-13945026 AGGGATCGGAGGGCTGTGAGAGG - Intronic
1021588079 7:22231417-22231439 AGGGTGATAAGGGCTTGGATAGG - Intronic
1026936462 7:74259290-74259312 AGGTCAGGAAGGGCTTTGATGGG + Intergenic
1030366048 7:108647244-108647266 AGGGTTGGAAGGGCTTTTATTGG + Intergenic
1034688994 7:152998976-152998998 AGGCTTGGAAGGGCTTGGAAAGG + Intergenic
1035770264 8:2141653-2141675 AGGGTTGGAATGTTTTTGATTGG + Intronic
1038408838 8:27342610-27342632 AGGGTTCGAAGGAATCTGAGAGG - Intronic
1044993805 8:97820064-97820086 ATGGTTGGAAAGCCTTTGATAGG + Intronic
1047895576 8:129362867-129362889 TGGTTTCGAATGGCTTTGAGTGG - Intergenic
1048174291 8:132137831-132137853 AAGGTTCATAGGGCTTTGAGGGG + Intronic
1048654617 8:136522277-136522299 AGGGATCCAAAGGCTTAGATTGG - Intergenic
1049343661 8:142127195-142127217 AGGGTGAGAAGGGCTTTCCTGGG + Intergenic
1050853584 9:10321331-10321353 AGAGTGAGAAGGGCATTGATTGG + Intronic
1060555031 9:124503683-124503705 CGGGTTCGATGCGCTTCGATTGG + Intronic
1061534098 9:131236946-131236968 AGGGTTCAAAGTGTTTTGAGTGG - Intergenic
1061931795 9:133836881-133836903 AGGGATAGGAGAGCTTTGATTGG - Intronic
1192170877 X:68853999-68854021 AGGGGTGGAAGGGCCTTGAATGG - Intergenic
1194004077 X:88469146-88469168 AGTTTTCCAAGGGCTTTTATTGG - Intergenic
1195280157 X:103325027-103325049 ATGGTTGGAAGGGCATTTATAGG - Intergenic
1201455916 Y:14166634-14166656 AAGCTTTGAAGGGCATTGATAGG - Intergenic