ID: 952979560

View in Genome Browser
Species Human (GRCh38)
Location 3:38723734-38723756
Sequence CCATTGCCAGCACTCCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952979560_952979569 25 Left 952979560 3:38723734-38723756 CCCTGATGGAGTGCTGGCAATGG 0: 1
1: 0
2: 2
3: 9
4: 136
Right 952979569 3:38723782-38723804 AACGACTCTCAGCATTCACTGGG 0: 1
1: 0
2: 0
3: 3
4: 82
952979560_952979568 24 Left 952979560 3:38723734-38723756 CCCTGATGGAGTGCTGGCAATGG 0: 1
1: 0
2: 2
3: 9
4: 136
Right 952979568 3:38723781-38723803 TAACGACTCTCAGCATTCACTGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952979560 Original CRISPR CCATTGCCAGCACTCCATCA GGG (reversed) Intronic
901530991 1:9852363-9852385 CCACTGCCAGCTCGCCTTCATGG + Intronic
903169250 1:21541898-21541920 CCATTGACAGCACCCCATCCTGG - Intronic
905032726 1:34898620-34898642 ACATAGCCAGCACTCAATAAAGG - Intronic
905347070 1:37318535-37318557 CCAAAGGAAGCACTCCATCACGG + Intergenic
907122146 1:52017203-52017225 CCACTGCACGCACTCCATCCTGG + Intergenic
907149692 1:52272329-52272351 ACATCTCCAGCACTCCATAAGGG + Intronic
907680109 1:56555195-56555217 CCATTTCCACTCCTCCATCATGG + Intronic
912200474 1:107452225-107452247 TCCTTCCCAGCACTTCATCAAGG - Intronic
914929813 1:151921032-151921054 CCATTACCTGCAAGCCATCAGGG - Intergenic
915514691 1:156406000-156406022 CCTTTGCCAGCTCTCCAACCTGG + Intronic
916877087 1:168980913-168980935 CCATTGCCACCACTTCTTCAGGG - Intergenic
917720867 1:177785299-177785321 CCATTGCCTCCATTGCATCAAGG + Intergenic
919433357 1:197525031-197525053 TCAATGGCAGCACTCTATCAGGG + Intronic
921213520 1:212919108-212919130 CCATTGCAACCACCCCATGAGGG + Intergenic
923532034 1:234819169-234819191 CCATAGTCAACCCTCCATCAAGG - Intergenic
923967196 1:239155234-239155256 CAATTGCCAGCACCACATTAAGG - Intergenic
1065960700 10:30732053-30732075 CCAAGGCCACCACCCCATCACGG - Intergenic
1066379484 10:34889118-34889140 CCATTTCCAGCACACCATCAGGG + Intergenic
1069969635 10:72155437-72155459 ACATTGCCATCACCCCATGAGGG - Intronic
1070094102 10:73319588-73319610 TCATTGCCTGCAAGCCATCAGGG + Intronic
1071567802 10:86680660-86680682 CCATTGCCAGCACGTCCTAAGGG - Intronic
1071595636 10:86921613-86921635 CCACTTCCAGCCCTACATCATGG + Exonic
1076440493 10:130477985-130478007 ACATTGGCAGCACACCAACATGG - Intergenic
1082668210 11:56001855-56001877 CCATATGCAGCACTCCATTAAGG - Intergenic
1083745924 11:64736490-64736512 CCATTGCCAGAACTCAACCCGGG + Intronic
1085301385 11:75460876-75460898 CCCTTGCCACCACCCCAACAGGG + Intronic
1085364047 11:75921200-75921222 CCATTGCCAGCACAGAATCAGGG - Intronic
1089191403 11:116656154-116656176 CCACAGCCAGAACTCCAGCAGGG + Intergenic
1089834927 11:121362167-121362189 CCACTTCCAGCCCTACATCATGG - Intergenic
1090871375 11:130752393-130752415 CCACTGCATGCACTCCATCCTGG + Intergenic
1097728021 12:63096572-63096594 CCATTCCCAGAGCCCCATCAGGG + Intergenic
1098907629 12:76178372-76178394 CCCTGGCCAGCACTCAATCTTGG - Intergenic
1100442643 12:94630596-94630618 CCATTGCCAGCACTATGACAAGG - Intronic
1102245382 12:111352672-111352694 CCACTCCCACCACTCCATGATGG - Intergenic
1103083873 12:118046421-118046443 CCACTGCCTGCACTCCAGCCTGG + Intronic
1103538933 12:121652772-121652794 CCTCCGCCAGCACACCATCAGGG + Exonic
1104841113 12:131826399-131826421 CCAGTGCCCCCACTGCATCATGG - Intergenic
1115095993 14:29636363-29636385 CCATTGCCATCTCTGCATCTTGG + Exonic
1117335236 14:54751780-54751802 CATTTGACAGCACTTCATCAGGG - Intronic
1117605190 14:57421681-57421703 CCAGTGCCAGAACTCCCTAAGGG + Intergenic
1119898908 14:78243579-78243601 GCATGGCCTGAACTCCATCAAGG - Intronic
1122294524 14:100697856-100697878 CCTTTGCCATCACCCCAGCACGG + Intergenic
1122445738 14:101767211-101767233 CCAGTGCCACCACTCCCTGATGG + Intronic
1122590546 14:102846903-102846925 GCATTGCCAGAACTCCAGAAAGG - Intronic
1125793799 15:42389600-42389622 CCATGGCCAGGCCTCCTTCAGGG + Intronic
1127264290 15:57348996-57349018 CCATGGAGAGCACTCCCTCATGG - Intergenic
1127359237 15:58230437-58230459 CCACTTCCAGAATTCCATCAGGG - Intronic
1130005936 15:80097607-80097629 CCATTGCATGCACTCCAGCCTGG + Intronic
1130021514 15:80235394-80235416 TCTTGGCCAGCACTCCACCAGGG - Intergenic
1131524461 15:93141912-93141934 CCATTGGCAGCACCCCATCCTGG + Intergenic
1133258656 16:4534404-4534426 CCATTGTGATCACTGCATCACGG - Intronic
1136996008 16:35188436-35188458 CCATTGACAGCATCACATCAGGG + Intergenic
1137859869 16:51835706-51835728 TCATGGCTATCACTCCATCAAGG - Intergenic
1139895645 16:70286412-70286434 CCATTGCCTGCGCTCCAGCCTGG - Intronic
1140922659 16:79553264-79553286 CCATTGCCACCTCTCCATCATGG + Intergenic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1142106906 16:88309239-88309261 AAATTGCCAGCACACCACCACGG - Intergenic
1144728067 17:17511671-17511693 GCATTGCCCGCTCTCCGTCATGG - Intronic
1145179520 17:20733850-20733872 CCATTCACTGCACTCCATCCTGG + Intergenic
1147447269 17:40482168-40482190 CGTGTGCCAGCATTCCATCATGG - Exonic
1147560589 17:41506581-41506603 ACATTCCCAGCATTCCATAAAGG + Intergenic
1158546456 18:58401943-58401965 CCATTGCATGCACTCCAGCCTGG + Intergenic
1161568221 19:5015289-5015311 CCATTGCACGCACTCCAACCTGG - Intronic
1162533386 19:11248683-11248705 CAATTACCAGCACCTCATCATGG + Intronic
1163189688 19:15668256-15668278 CCATTGCATGCACTCCAGCCTGG - Intergenic
1166516187 19:43448770-43448792 CCACTGACAGCACTCCAGCCTGG + Intergenic
1168483168 19:56738523-56738545 TCCTTGCCAGCCCTCCACCATGG + Intergenic
926424188 2:12726420-12726442 ACATTGCCAGCACTTCCTGAGGG + Intronic
927486211 2:23489980-23490002 CCATTGCCAACACTAGAGCAAGG - Intronic
928501950 2:31905931-31905953 ATATTGCCATCACACCATCAAGG + Intronic
931351409 2:61492172-61492194 CCATATCCTGGACTCCATCATGG + Exonic
932327661 2:70873742-70873764 CTCTTTCCAGCACTCCCTCAGGG - Intergenic
932941792 2:76175294-76175316 CTATTTCCATCACTCCATCATGG + Intergenic
933781027 2:85801315-85801337 CCATTGACAGCACTCCAGGAAGG - Intergenic
935734855 2:106098255-106098277 GCATTGGGAGCACCCCATCAAGG - Intronic
936041676 2:109154657-109154679 CCCTGGCCAGCACTACAGCAAGG - Intronic
936057238 2:109270305-109270327 CCATGCCCGGCACTCCAACAGGG - Intronic
938115700 2:128601860-128601882 GCAGTGCCAGCACTCCCTCTGGG + Intergenic
939579558 2:143931679-143931701 CCATTGCCAGAGCTCCTTAATGG - Intergenic
939923045 2:148140803-148140825 CCACTGCCTGCACTCCAGCCTGG - Intronic
940464815 2:154014226-154014248 CCAGTGCCAGGACTCCAACCTGG - Intronic
1172755343 20:37279960-37279982 CCTTTGCCAGAACTCTCTCATGG - Intergenic
1175989221 20:62779195-62779217 CCATTCCCAGCTCACCCTCAGGG + Intergenic
1179536723 21:42057623-42057645 GCAGTGCCAGCCCTGCATCATGG + Intergenic
1179984338 21:44912667-44912689 CCAGTTCCAGCTCTCCATCTGGG + Intronic
1181645936 22:24231938-24231960 GCACTGCCTGCACTCCCTCAGGG + Intronic
1181946231 22:26519863-26519885 CCACTGCCTGCACTCCAGCCTGG - Intergenic
1184265894 22:43345784-43345806 CCATAGCCAGGCCTCCAGCACGG + Intergenic
1184646045 22:45896027-45896049 CCATTGCCAGATCTGCAGCATGG - Intergenic
950051041 3:9990062-9990084 CCACTGCCTGCACTCCAGCCTGG - Intronic
951714486 3:25625156-25625178 AAATTGCCAGCATGCCATCAAGG + Intronic
952979560 3:38723734-38723756 CCATTGCCAGCACTCCATCAGGG - Intronic
953296314 3:41721405-41721427 CCACTGCATGCACTCCAGCAGGG - Intronic
953785259 3:45906628-45906650 CCTTTGCCAGCACACCTTCATGG - Intronic
956443413 3:69302633-69302655 CCATTTCCAGGAGTACATCAAGG + Intronic
957800694 3:85076385-85076407 CCATTGCCCTCACTCCAGCCTGG - Intronic
961002224 3:123381742-123381764 CCACTGCCAGCACTAGATCCAGG + Intronic
961475426 3:127143001-127143023 CCTTAGTCAGCACTCCATCCTGG + Intergenic
964503490 3:157373847-157373869 ACATTGCCCGCACTCCATACTGG + Intronic
965443743 3:168748829-168748851 CCCTAGCCAGCACTCCAACTGGG + Intergenic
973627979 4:52791635-52791657 CCAATACCAGCACTCAATCTAGG + Intergenic
973863512 4:55088943-55088965 CCCGTGCCAGCAGTCCAGCATGG + Exonic
975892941 4:79050713-79050735 CCATTGCCGGCGCTCCAGCTGGG + Intergenic
979742183 4:124165732-124165754 GCTTGGGCAGCACTCCATCATGG + Intergenic
982158354 4:152542136-152542158 CTATTGCCAGCAATCCCTCATGG + Intergenic
984382579 4:179014598-179014620 CCATTGACAGCATCCCACCAGGG + Intergenic
985444267 4:190012447-190012469 CCATACCCAGTACTACATCAAGG + Intergenic
985820063 5:2153577-2153599 CCACTGCCAGCACTGCAGCCAGG + Intergenic
989672857 5:43938488-43938510 CCACTGCAAGCACTCCAGCCTGG + Intergenic
994578809 5:101613076-101613098 CAAATGGCAGCTCTCCATCAGGG - Intergenic
996294011 5:121890340-121890362 CCTTTGCCAGACTTCCATCAAGG + Intergenic
997417370 5:133739410-133739432 CCACTGCCAGCAGAACATCAAGG + Intergenic
1002717292 5:181235473-181235495 CCTTTTCCAGCACTCAACCAAGG + Exonic
1005664074 6:28032170-28032192 CCATTTCCACCTCTACATCAAGG - Intergenic
1006002951 6:30980727-30980749 CCACTGCCCGCACTCCAGCCTGG - Intergenic
1008025558 6:46631878-46631900 CCAGTGACGGCTCTCCATCATGG + Intronic
1013159871 6:107532729-107532751 CCATTACCATCCCTCCATCCAGG + Intronic
1013747654 6:113364909-113364931 ACATTTCCAGCACTCCATGCTGG - Intergenic
1015075938 6:129157840-129157862 CCACTTCCAGCCCTACATCATGG - Intronic
1015703483 6:136061922-136061944 ACATTGCCAGAACTCAAACATGG + Intronic
1016747759 6:147599163-147599185 TCTTTACCATCACTCCATCAAGG - Intronic
1021461264 7:20889335-20889357 ACATTCCCAGGACTCCATTATGG + Intergenic
1023554620 7:41408523-41408545 CCATTGCACGCACTCCAGCCTGG - Intergenic
1029797455 7:102910242-102910264 CCAGTGCCACCCCTCCAACATGG - Intronic
1031217194 7:118910128-118910150 GCATTTCCAGAACTCCAACAAGG + Intergenic
1031943392 7:127813599-127813621 CCATTGCTTGCACTCCAGCCTGG - Intronic
1032641976 7:133780032-133780054 TTATCGCCAGCACACCATCAGGG - Intronic
1032791104 7:135243083-135243105 CCTTTGGCAGCACTCCAGTAGGG - Intronic
1034092063 7:148372666-148372688 CCACTGCATGCACTCCATCCTGG + Intronic
1034520257 7:151614145-151614167 CCCCAGCCAGCACTCCAACACGG + Intronic
1040889200 8:52298064-52298086 TCATGGCCAGCCCTGCATCAGGG - Intronic
1041144790 8:54862601-54862623 CCATTCCCAGCCAGCCATCAGGG + Intergenic
1045416527 8:101973086-101973108 CCAGGGCCAGCACTCTAACAAGG + Intronic
1046807098 8:118490951-118490973 TGCTTGCCAGCATTCCATCAGGG - Intronic
1046870322 8:119198249-119198271 ACATTGCCAGAACTGGATCAAGG - Intronic
1048552251 8:135444468-135444490 CCTTTGCCAGAACTTCATAACGG - Intergenic
1049011455 8:139890293-139890315 CCGTTCCGAGCACCCCATCAGGG + Intronic
1049257260 8:141620594-141620616 CCACCCCCAGCACTCCATCTTGG - Intergenic
1050123869 9:2336252-2336274 CCATTGCCAGATTTCCAGCAGGG + Intergenic
1053101691 9:35376807-35376829 CTATTGTCCCCACTCCATCATGG - Intronic
1054872608 9:70062314-70062336 CCATTCCCAGCCCTCTACCAGGG + Intronic
1056267524 9:84914476-84914498 CCTCTGACAGCACTCCACCAGGG + Intronic
1058216218 9:102237219-102237241 CCTTTGCCTGCACTGCATCCTGG + Intergenic
1059707559 9:116839185-116839207 CCACTGCCTGCACTCCAGCCTGG - Intronic
1059800936 9:117748944-117748966 CCACTTCCTGCCCTCCATCATGG + Intergenic
1061443969 9:130627152-130627174 CCATTGGCAGCAGTTCATCTTGG + Intronic
1197610665 X:128634744-128634766 CCAATCACAGCACTGCATCAGGG + Intergenic
1198392049 X:136186116-136186138 CCATTGCCACTAATCCATCATGG + Intronic