ID: 952980163

View in Genome Browser
Species Human (GRCh38)
Location 3:38727800-38727822
Sequence GACCCCACCATGACCAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952980160_952980163 -9 Left 952980160 3:38727786-38727808 CCCAGGAGGGCAAGGACCCCACC 0: 1
1: 0
2: 6
3: 36
4: 281
Right 952980163 3:38727800-38727822 GACCCCACCATGACCAGAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 122
952980161_952980163 -10 Left 952980161 3:38727787-38727809 CCAGGAGGGCAAGGACCCCACCA 0: 1
1: 0
2: 2
3: 40
4: 300
Right 952980163 3:38727800-38727822 GACCCCACCATGACCAGAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 122
952980158_952980163 0 Left 952980158 3:38727777-38727799 CCAGTCAGTCCCAGGAGGGCAAG 0: 1
1: 0
2: 1
3: 26
4: 228
Right 952980163 3:38727800-38727822 GACCCCACCATGACCAGAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 122
952980152_952980163 12 Left 952980152 3:38727765-38727787 CCTCCCACACAACCAGTCAGTCC 0: 1
1: 0
2: 1
3: 27
4: 229
Right 952980163 3:38727800-38727822 GACCCCACCATGACCAGAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 122
952980153_952980163 9 Left 952980153 3:38727768-38727790 CCCACACAACCAGTCAGTCCCAG 0: 1
1: 0
2: 0
3: 10
4: 186
Right 952980163 3:38727800-38727822 GACCCCACCATGACCAGAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 122
952980154_952980163 8 Left 952980154 3:38727769-38727791 CCACACAACCAGTCAGTCCCAGG 0: 1
1: 0
2: 0
3: 28
4: 241
Right 952980163 3:38727800-38727822 GACCCCACCATGACCAGAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952980163 Original CRISPR GACCCCACCATGACCAGAGT GGG Intronic
901145958 1:7064762-7064784 GCCCCCACCATGCCCCGAATGGG - Intronic
904860985 1:33537495-33537517 GAGCCCACCAGCACCAGAGGGGG + Exonic
905470022 1:38184945-38184967 GACACTACCAGGACCAGAATAGG + Intergenic
912777709 1:112516257-112516279 GCCGACACCATGACCAGCGTGGG + Exonic
912954664 1:114146404-114146426 GGCCCCAGCAAGCCCAGAGTGGG - Intronic
915585651 1:156842453-156842475 AACTCCATGATGACCAGAGTTGG + Exonic
919793680 1:201308502-201308524 GTCTCCATAATGACCAGAGTTGG - Intronic
921922055 1:220681092-220681114 GACCCAACCATGAGCACTGTGGG + Intergenic
1063374369 10:5545260-5545282 GAGGCCACTATGACCAGAGGTGG + Intergenic
1067757468 10:49015889-49015911 GACACCAACAGGACCAGAGGAGG - Exonic
1069430737 10:68332174-68332196 GACCCCGCGAGCACCAGAGTCGG + Exonic
1071431502 10:85610585-85610607 GACCCCACCATGCCCTGGCTGGG + Intronic
1076399931 10:130175853-130175875 GATGCCACCATGCCCACAGTGGG - Intronic
1076449489 10:130546953-130546975 AACCCCACCATCACCACAGTGGG + Intergenic
1077137290 11:1007171-1007193 GACCCCAGCTTGACCAGAGATGG + Intronic
1077452159 11:2654722-2654744 GACCCCTCCCTGCCCAGATTAGG - Intronic
1077466393 11:2735633-2735655 GTCACCACCAAGACCACAGTGGG + Intronic
1078614239 11:12850234-12850256 GAGCCCAGCATGACCAGCGTGGG + Intronic
1083804823 11:65067408-65067430 GACCCCAGCATTACCTGAGAGGG + Intronic
1083843319 11:65316661-65316683 GACCCCACCATGCCGTGACTGGG + Intronic
1084455090 11:69263812-69263834 GCCCCCACCATGAAGAGACTGGG + Intergenic
1084683692 11:70681507-70681529 CACCCCACCATGCCCAGAAATGG + Intronic
1084734680 11:71097022-71097044 GACACAGCCATGAACAGAGTGGG - Intronic
1085532596 11:77200913-77200935 GACCCCACCCTGTCCTCAGTGGG + Intronic
1090262054 11:125328197-125328219 GATCCCACAATGGCCAGAGCAGG - Intronic
1092622351 12:10286083-10286105 GGCCACACCAAGACCAGTGTAGG + Intergenic
1092721854 12:11449008-11449030 GACCCCACCATGACCATTTTAGG - Intronic
1093377127 12:18443266-18443288 GACAGCACCATGTACAGAGTAGG - Intronic
1101193916 12:102363138-102363160 GATGCCACCATGACCACACTAGG - Intergenic
1103337027 12:120197292-120197314 GATCCCACCAGGACCACAGTGGG - Intronic
1111700191 13:91677066-91677088 GACTGCAACATGACCAAAGTGGG + Intronic
1112190823 13:97175649-97175671 GCCCCCAACAAGAGCAGAGTTGG + Intergenic
1112338066 13:98530776-98530798 GCCACCACCTTCACCAGAGTTGG + Intronic
1113588623 13:111482904-111482926 GCCCCCACCATCATGAGAGTTGG + Intergenic
1116182047 14:41547136-41547158 TCCCCCAACATGACAAGAGTAGG + Intergenic
1116554709 14:46288366-46288388 GACCTCACTTTGACCAGGGTGGG + Intergenic
1119412060 14:74438688-74438710 CACCCAACCATGAGCATAGTTGG + Intergenic
1119519544 14:75276065-75276087 GGCACCATTATGACCAGAGTTGG - Intergenic
1121787656 14:96674469-96674491 CACCCCACCATGACCATGGAAGG - Intergenic
1123826098 15:24083802-24083824 GCCCCTTCCATGATCAGAGTAGG + Intergenic
1123948101 15:25248625-25248647 GCACCCACCATGCCCAGGGTAGG + Intergenic
1128215264 15:65930273-65930295 GCCCCCACCATGAACAGGGAAGG - Intronic
1128695679 15:69760688-69760710 GACCCCAGTCTGACCACAGTGGG + Intergenic
1128732812 15:70032766-70032788 GACCCCAACACCACCAGAGATGG + Intergenic
1129452424 15:75658482-75658504 GACCACACCCTGACCTGGGTGGG - Exonic
1129684602 15:77677891-77677913 GCACCCACCATGCCCAGAGGAGG + Intronic
1130048782 15:80466242-80466264 GTCCCCATCAGGAACAGAGTTGG + Intronic
1133988272 16:10684877-10684899 GACCCCACCCTGCCCAGATGCGG + Intronic
1135056683 16:19237863-19237885 CACCCCACTATGGCCAGAGCAGG + Intronic
1137676952 16:50308505-50308527 CACCCAACCTTGACCAGAGCAGG - Intronic
1139526246 16:67518561-67518583 GATGCCATCATGAGCAGAGTTGG - Intronic
1143320009 17:6062108-6062130 GAGCCCACCATAACCAGCATGGG - Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1145819237 17:27818515-27818537 TCCCCCACCATTTCCAGAGTGGG - Intronic
1145822725 17:27852169-27852191 ACCCCCACCATCACCAGACTGGG + Intronic
1147531250 17:41280282-41280304 GACCACATGATGACCAGAGCAGG + Intergenic
1148124698 17:45230733-45230755 TACCCCACCCTGACCAGGCTGGG + Intronic
1151355000 17:73553131-73553153 GCCACCTCCATGCCCAGAGTGGG - Intronic
1152322733 17:79617258-79617280 GACCCCCCCATCCCCAGAGCAGG - Intergenic
1153981911 18:10317486-10317508 TACCCCACCATGACCCCAGTGGG + Intergenic
1155416518 18:25605122-25605144 GGCCCCACCATGAACAGAAGGGG + Intergenic
1157495884 18:48157091-48157113 GAACCCTGCTTGACCAGAGTTGG - Intronic
1161152457 19:2716878-2716900 GTTCCCACCAGGACCAGAGGAGG - Exonic
1161678999 19:5669663-5669685 GACCCCACCAATACCAGTGGTGG + Intergenic
1163817565 19:19476058-19476080 GTCCCCTCCATGACCAGAGGAGG - Intronic
1165060986 19:33205111-33205133 GACCCCTCCAACACCAGGGTGGG - Intronic
926319920 2:11742633-11742655 GACCTCAACATGACCAGGGATGG - Intronic
926751518 2:16202224-16202246 GACCTCACCCTGATCAGAGCTGG - Intergenic
928508184 2:31975776-31975798 GAACCCACAATGTCCAGAGTTGG + Intronic
928887881 2:36170816-36170838 GACCACCCGATGACCACAGTGGG + Intergenic
933629437 2:84639138-84639160 CACCCCACCATGCCCACAGTGGG - Intronic
933657703 2:84903304-84903326 AAGCCCACCATCAACAGAGTGGG - Intronic
943009768 2:182433071-182433093 GAGCCTGCCATGACCACAGTAGG - Intronic
947802170 2:232936466-232936488 GACCCCACCCTATCCAGAGTGGG - Intronic
948034719 2:234848647-234848669 GAGGCCACCATGATCTGAGTGGG - Intergenic
948139088 2:235659843-235659865 GACCCTCCCAGGACCAGAGGTGG - Intronic
948389307 2:237600700-237600722 AACCCCAGCATGAGCAGAGGTGG + Intronic
948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG + Intronic
948722818 2:239912197-239912219 GAGCCCAGCAGGACCAGAGGGGG - Intronic
1170073209 20:12391322-12391344 CTCCCCACCATGCCCACAGTGGG + Intergenic
1171122492 20:22578971-22578993 CACCCCACAATGAGTAGAGTTGG + Intergenic
1175861446 20:62152236-62152258 CACTCCACCATGAGCAGAGCGGG + Intronic
1175944367 20:62551769-62551791 GACCCCACCGTGAGCCGAGCTGG - Intronic
1176291410 21:5047012-5047034 GAAGCCACGATGACAAGAGTGGG - Intergenic
1178632736 21:34276888-34276910 GACCCCACCACAACGAGAATCGG - Intergenic
1179088860 21:38245059-38245081 GACACCTCCATGACCACAGAAGG + Intronic
1179865845 21:44216629-44216651 GAAGCCACGATGACAAGAGTGGG + Intergenic
1179884947 21:44309885-44309907 AAGCCCGCCATGGCCAGAGTGGG + Intronic
1180051705 21:45334680-45334702 GCCCCCATCATGAGCAGAGACGG - Intergenic
1182443895 22:30379438-30379460 GGCCCCACCATGTCCACACTGGG - Exonic
1183899848 22:40996788-40996810 GACTCCACCAGGACCACTGTGGG - Intergenic
1185420085 22:50730371-50730393 GATCCCGCCATGCCCAGAGCCGG + Intergenic
950477055 3:13221196-13221218 CACCCCACCGTGACCAGGGCGGG - Intergenic
952980163 3:38727800-38727822 GACCCCACCATGACCAGAGTGGG + Intronic
957203896 3:77169879-77169901 GACCCCAGGACGACCACAGTGGG - Intronic
957571233 3:81949640-81949662 GACACCAGCCTGACCAGGGTGGG + Intergenic
958170061 3:89928011-89928033 CACCCCACCAGGACCTCAGTTGG - Intergenic
962277683 3:134028721-134028743 GATCCCACCCTGACCAGAAGGGG + Intronic
962304108 3:134270643-134270665 GTATCCACCATGACCAGAGTTGG + Intergenic
965062443 3:163802123-163802145 GCCCCCAAAATGTCCAGAGTTGG - Intergenic
968954611 4:3711915-3711937 GGCCCCAGGATGACCACAGTTGG - Intergenic
970928448 4:21481402-21481424 GACCCTTCCAGGACCAGAGAGGG + Intronic
980731320 4:136827610-136827632 GATCCCACCATGGGCAGAGGAGG - Intergenic
981687734 4:147473616-147473638 GATTACAGCATGACCAGAGTGGG - Intergenic
992994406 5:82318313-82318335 GCCCCCACCATGTCCACAGTGGG + Exonic
994108704 5:95975944-95975966 GCCTCCAACATGACCAGAATAGG - Intergenic
994135566 5:96282697-96282719 AACCCCACAATGACAAAAGTTGG - Intergenic
995455289 5:112345159-112345181 GCCCACAGCATGTCCAGAGTTGG + Intronic
997866741 5:137470558-137470580 GACCCCACCATGCCCTGAAGTGG + Intronic
1002322145 5:178382553-178382575 TACCCCACCATGGCCAGAGTGGG + Intronic
1006509878 6:34515936-34515958 GCCCCCTCCCTGCCCAGAGTTGG - Intronic
1011504473 6:88027134-88027156 CTCCCCACCATGAACAGTGTGGG + Intergenic
1018478448 6:164166764-164166786 GACCCCAGCATGCGCAGAGGAGG - Intergenic
1018791997 6:167155753-167155775 GTCACCACCATGCCCAGAGGAGG - Intronic
1021046141 7:15925245-15925267 GACACCAGCTTGACCACAGTGGG + Intergenic
1023681776 7:42694806-42694828 ATCCCCACCATCACCATAGTGGG + Intergenic
1023905082 7:44516262-44516284 GCCTCCACCAGGACCAGCGTGGG + Intronic
1025851890 7:65250967-65250989 GAACCCTCCATCACCAGAGACGG + Intergenic
1028063322 7:86348791-86348813 GAACTCACTATCACCAGAGTGGG + Intergenic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1033477580 7:141705584-141705606 GACTCCACTCTGACCAGACTTGG - Intergenic
1034885042 7:154792828-154792850 GAACTCCCCATGACCACAGTGGG + Intronic
1042195325 8:66227240-66227262 CACCCCAGCATGTCCAGAATGGG - Intergenic
1042836595 8:73084632-73084654 GACCCAGCCATGCCCAGTGTAGG - Intronic
1047919109 8:129614966-129614988 ATCCCCACCATGACCAGATAAGG - Intergenic
1047939910 8:129819719-129819741 GACCCTCCCAAGAGCAGAGTGGG + Intergenic
1048589087 8:135804419-135804441 GTCTCCACCAACACCAGAGTAGG - Intergenic
1052560727 9:30079604-30079626 GACCCTACCATGCCCAGTGGAGG + Intergenic
1056271836 9:84954745-84954767 GTCCCCACCAGCACCAGAGCTGG - Intronic
1060831357 9:126719735-126719757 GACCCAACCCAGCCCAGAGTGGG + Intergenic
1061669891 9:132182777-132182799 GACCCCACCAGGAGCGGAGCGGG + Intronic
1061870776 9:133519161-133519183 GACCCCTCCATGACCAGGCTGGG - Intronic
1061938856 9:133873406-133873428 GACTCCACCGTGAGCACAGTGGG - Intronic
1188140796 X:26548180-26548202 GACACCAGCATGGCCACAGTGGG - Intergenic
1191856583 X:65631968-65631990 CACCCCACCATGCCCAGCCTGGG + Intronic
1194494394 X:94594147-94594169 GACCCCACCAGGACTAGAAGCGG + Intergenic
1201907989 Y:19104815-19104837 GACCCTCCCATAAACAGAGTTGG + Intergenic