ID: 952984130

View in Genome Browser
Species Human (GRCh38)
Location 3:38762527-38762549
Sequence TGGAGTATTTGCAGAACCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952984123_952984130 25 Left 952984123 3:38762479-38762501 CCAGAAGAAGGGGCAGCACAGTA 0: 1
1: 0
2: 1
3: 12
4: 170
Right 952984130 3:38762527-38762549 TGGAGTATTTGCAGAACCGTAGG 0: 1
1: 0
2: 0
3: 5
4: 91
952984122_952984130 26 Left 952984122 3:38762478-38762500 CCCAGAAGAAGGGGCAGCACAGT 0: 1
1: 0
2: 3
3: 22
4: 260
Right 952984130 3:38762527-38762549 TGGAGTATTTGCAGAACCGTAGG 0: 1
1: 0
2: 0
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952984130 Original CRISPR TGGAGTATTTGCAGAACCGT AGG Intronic
904804776 1:33123046-33123068 TGGAGTGTTTGAAGAACAGAGGG - Intergenic
910708305 1:90153266-90153288 TGAAGAATTTGCAGGACTGTTGG - Intergenic
911123230 1:94316516-94316538 TTGAGTATTTGCTGAAAGGTAGG + Intergenic
914861808 1:151392405-151392427 TGGAATATTTGCTGAACACTGGG + Intergenic
922052556 1:222007975-222007997 TGAAGTATTTCAAGAACTGTGGG + Intergenic
923242485 1:232099216-232099238 TGGAGAATTTGAAGAACACTTGG + Intergenic
924446618 1:244138640-244138662 TGGAGCATTTCCCGGACCGTGGG + Intergenic
1072394904 10:95028667-95028689 TGGAGTAGTTTCAGAAACATTGG + Intergenic
1075998472 10:126896470-126896492 TGATGTATCAGCAGAACCGTGGG + Intergenic
1077175579 11:1188581-1188603 GGGAGTAGTTCCAGAACCGGAGG - Intronic
1077175807 11:1189880-1189902 GGGAGTAGTTCCAGAACCGGAGG - Intronic
1077175974 11:1190798-1190820 TGGAGTAGTTCCAGAACCGGAGG - Intronic
1078580730 11:12537622-12537644 TGGTGTATCTTCAGAACCTTTGG + Intergenic
1081298618 11:41423207-41423229 TGGATTATTTGGAGACCCATGGG + Intronic
1081748704 11:45491543-45491565 TGGGGTGTTTGCAGAACAGCAGG + Intergenic
1081923076 11:46797497-46797519 TGGAGTATTTGAAGATCATTTGG - Intronic
1083100070 11:60294091-60294113 TGGAGATTTTGCAGAACAGCAGG - Intronic
1085155035 11:74285808-74285830 TAGAGAACTTGCAGAACCATGGG - Exonic
1088434166 11:109792400-109792422 TGGAGGATGAGCAGAACAGTTGG - Intergenic
1091628446 12:2140235-2140257 TGGACGATTTGCAGAATGGTCGG + Intronic
1097973410 12:65659485-65659507 TGGAGTGTTTGAGGAACAGTCGG - Intergenic
1099545955 12:83979935-83979957 TGCACTATTTGCAGAACCAAAGG + Intergenic
1099841080 12:87968211-87968233 TGGATTATTTGCAGAGCCTCAGG + Intergenic
1103254536 12:119529606-119529628 TGGAGTCTTTGCAGAGTTGTTGG + Intronic
1107231804 13:38118936-38118958 TGGAGTAGTTGGATAACCTTCGG - Intergenic
1110808654 13:79788769-79788791 TGGAGTCTTGGCAGAACAGCTGG + Intergenic
1115074692 14:29373707-29373729 TGAATTGTTTGAAGAACCGTGGG - Intergenic
1115395052 14:32899288-32899310 TGAAGTTTTTGCAGACCAGTTGG - Intergenic
1116031472 14:39577695-39577717 TAGAGAATGTGCACAACCGTTGG + Intergenic
1120295243 14:82631981-82632003 TGGAGATTGTGCAGAACCCTGGG - Intergenic
1121888472 14:97566754-97566776 TGGACTCTTTGCAGACCTGTTGG + Intergenic
1122224833 14:100268900-100268922 TGGGATATTTGCAGATCTGTTGG + Intronic
1122340358 14:101024099-101024121 TGGAGTAATTGAAGAAACGGTGG + Intergenic
1124352265 15:28965186-28965208 TGGAGTATTTGCACATCTATAGG - Intronic
1127900159 15:63335169-63335191 TGTAGCATTGGCAGCACCGTTGG - Intronic
1132133475 15:99308066-99308088 TAGAGTGTTAGCAGAACTGTTGG + Intronic
1134869646 16:17640251-17640273 AGGAGTATTTGAGGAACTGTAGG + Intergenic
1135461335 16:22646048-22646070 TGGGGTAGTTGCAGAACCATTGG - Intergenic
1147632760 17:41942715-41942737 TGGAGGACTTGGAGAACCATAGG + Intronic
1151203127 17:72483540-72483562 TGTGGGATTTGGAGAACCGTGGG - Intergenic
1155210742 18:23598570-23598592 TGGTGGTTTTGCAGAACTGTTGG - Intergenic
1155247715 18:23925723-23925745 TGGAGTAAATGTAGAACTGTAGG + Intronic
1155322395 18:24632114-24632136 GGGACTATTTGCAGAGCTGTAGG - Intergenic
1160627929 18:80225718-80225740 TGAAGTAGTTGGAGAAGCGTGGG + Intronic
1167257216 19:48437954-48437976 CGGAGAATTAGCAGAAACGTGGG - Intronic
925340301 2:3131261-3131283 TGGTGTGTGGGCAGAACCGTAGG + Intergenic
926584873 2:14674970-14674992 TGGAGTATGAGCAGAAGCTTTGG - Intergenic
928296419 2:30088032-30088054 TGGTTTATTTGCAGGACCGTGGG + Intergenic
935590747 2:104844000-104844022 TGGAGTGTTTGCGGAACCCGTGG - Intergenic
935636638 2:105254248-105254270 TGGAGAATTCCCAGAACCATGGG + Intergenic
939300863 2:140336081-140336103 TGAAATATTTCCAGAACCATAGG + Intronic
941186512 2:162326404-162326426 TGGAGTGTATGCTGAACCATTGG - Intronic
941193060 2:162411091-162411113 TTGAGTATTTGCCCAACAGTGGG - Intronic
941961149 2:171255163-171255185 GGGAGTATTAGCAGGACCTTGGG - Intergenic
945237119 2:207641381-207641403 TCGTGTATTTGCAGAAAAGTGGG - Intergenic
946411522 2:219517485-219517507 TGCAGTATGTGCAGAAGAGTAGG - Intronic
1169874002 20:10276333-10276355 TGCAGTATTTGCAGATTCTTGGG - Intronic
1170706065 20:18745678-18745700 TGGAGGAATTGCAGAAGGGTGGG + Intronic
1173371364 20:42439426-42439448 TGGAGTAATTGAAGAAACATAGG - Intronic
1180119521 21:45737523-45737545 TGGTTTATTTCCAGAACTGTAGG - Intronic
1181286996 22:21759468-21759490 TGGGGTATTTGAAGCACTGTGGG - Exonic
952893870 3:38063834-38063856 TGGAGTATCAGCACAACTGTGGG - Exonic
952984130 3:38762527-38762549 TGGAGTATTTGCAGAACCGTAGG + Intronic
955923393 3:63981825-63981847 AAGACTATTTGCAGAACCCTTGG - Intronic
959772260 3:110112389-110112411 AGCAGTATTTGAAGAACAGTAGG - Intergenic
962651219 3:137494686-137494708 TGGAGCATTGGCAGAACAGTAGG - Intergenic
967804835 3:193706459-193706481 TGGAGGATCTGCATAACCGTGGG + Intergenic
968259051 3:197304399-197304421 TGTGGTATTGACAGAACCGTAGG + Intergenic
975490962 4:74988201-74988223 TGGATAATTTGCACAACTGTGGG + Intronic
978351011 4:107820720-107820742 TGCAGGATTTGCAGATCAGTTGG - Intergenic
983192300 4:164767588-164767610 TGGAGCATCTGAAGAACAGTTGG - Intergenic
984505985 4:180619336-180619358 AGTAGTATTTGCAGAAACTTGGG + Intergenic
997513003 5:134466087-134466109 GGGAGTATTTCCAGAACTGCTGG - Intergenic
1006059106 6:31406046-31406068 TGGAGTATATGCCTAACAGTGGG + Intronic
1006530563 6:34649099-34649121 TGGAGTATTTAAAGAACCTCTGG + Intronic
1007998403 6:46333409-46333431 GGGACTAATTGCAGAAACGTTGG - Intronic
1009636084 6:66266131-66266153 GGGAGAATTTGCAGAACCTGAGG - Intergenic
1009725426 6:67531316-67531338 TGGAGTATATTCTGAACCATTGG - Intergenic
1011339575 6:86298972-86298994 TGGAGTAAATGCAGAAGGGTGGG + Intergenic
1012749253 6:103137192-103137214 TGGAGTATTTGAAGAAAAGGTGG - Intergenic
1014254236 6:119145365-119145387 GGGTGTATTTGCAGAAGTGTGGG - Intronic
1019187782 6:170230977-170230999 TGGAGTGTTTGCAGGACTCTGGG + Intergenic
1020330743 7:7014450-7014472 AGGAGTTCTTGCAGAACCCTGGG + Intergenic
1021082033 7:16376005-16376027 TGGAGAATTTCCAGAACTGATGG - Intronic
1022879386 7:34570148-34570170 TGAAGAATTTGCAGAACTGAGGG + Intergenic
1041450641 8:58003273-58003295 AGGAGTAATTGCAGATCCGGTGG - Intronic
1049821730 8:144638420-144638442 GGCAGTATTTGAAGAGCCGTTGG - Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057463455 9:95289351-95289373 CGGAGTATTTGCACAACCAGTGG + Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1061027479 9:128059478-128059500 TGGAGTTTCTGCTGAACAGTTGG - Intergenic
1186249262 X:7648401-7648423 TGGAGGATTTTCAGAAGCATTGG - Intergenic
1190186747 X:48241634-48241656 TGGAGCAGTTGCAGAGCCATAGG + Intronic
1190187438 X:48248055-48248077 TGGAGCAGTTGCAGAGCCATAGG - Intronic
1190656320 X:52615824-52615846 TGGAGCAGTTGCAGAGCCATAGG - Intergenic
1198879873 X:141268292-141268314 TAGTGTATTTGTAGAACCTTTGG - Intergenic
1199418231 X:147611831-147611853 TGTAGTCATTGGAGAACCGTAGG - Intergenic