ID: 952985966

View in Genome Browser
Species Human (GRCh38)
Location 3:38783628-38783650
Sequence TGCCCATAAAAACCCCAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952985966_952985967 11 Left 952985966 3:38783628-38783650 CCGGTTTGGGGTTTTTATGGGCA 0: 1
1: 0
2: 2
3: 21
4: 224
Right 952985967 3:38783662-38783684 ACTTTCTTGTAGCTGTAATCTGG 0: 1
1: 0
2: 0
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952985966 Original CRISPR TGCCCATAAAAACCCCAAAC CGG (reversed) Intronic
901623811 1:10611424-10611446 TACTCATAATAGCCCCAAACTGG - Intronic
902175033 1:14643074-14643096 TGTGCATAATAACCCCAAACTGG + Intronic
902590500 1:17470598-17470620 TGTGCATAAGAGCCCCAAACTGG - Intergenic
905608669 1:39328567-39328589 TGCAAAAAAGAACCCCAAACAGG - Intronic
905760522 1:40553219-40553241 TCCCCATGCAAACCACAAACGGG + Intergenic
906706530 1:47899173-47899195 TGCACATAAGAACCCCCACCTGG - Intronic
909547230 1:76861136-76861158 TGCTCGTAAGAACCCCAAACTGG + Intergenic
911249531 1:95559123-95559145 TTCCCATAAAACCCCCAGAAAGG - Intergenic
912202706 1:107476560-107476582 TGCATCTAAATACCCCAAACAGG + Intronic
912327616 1:108783588-108783610 TGTTCATAATAATCCCAAACTGG - Intronic
912370926 1:109173456-109173478 TCCACCTAAAAACCACAAACAGG - Exonic
917582264 1:176391221-176391243 TCCCCATGAAAACCCCATCCAGG - Intergenic
918096386 1:181338384-181338406 TGCACATCAAAACCACAAAGGGG - Intergenic
919105742 1:193148310-193148332 TGCCAAAAAGAACCCCAAACTGG - Intronic
920484298 1:206354399-206354421 TTCCCATGAAAACCCCAGAAAGG - Intronic
921776794 1:219110968-219110990 TACCCATAATAACTCAAAACTGG + Intergenic
923617243 1:235548099-235548121 TCTCCATAATAACCCCGAACAGG - Exonic
924043475 1:240006255-240006277 GGCCCATAAAATCCCCCCACGGG + Intergenic
924083998 1:240429826-240429848 TGCTAATAATAACCCCAAATTGG - Intronic
924735872 1:246755240-246755262 TTCCCATCAAAATCACAAACAGG + Intronic
924763538 1:247010643-247010665 TGTTCATAAAAACCCAAAATAGG - Intergenic
1063358157 10:5422001-5422023 TATCCATAAAAGCACCAAACTGG - Intronic
1064917334 10:20474519-20474541 TGCCTTTAAAATGCCCAAACTGG + Intergenic
1070763579 10:79043457-79043479 TATTCATAAAATCCCCAAACTGG + Intergenic
1071475921 10:86024854-86024876 TGCCAAGAAAACACCCAAACAGG + Intronic
1071612437 10:87043813-87043835 GTCTCAAAAAAACCCCAAACAGG + Intergenic
1074755143 10:116618947-116618969 TGTTCATAATAGCCCCAAACTGG + Intergenic
1077772549 11:5235894-5235916 TAATCATAAAAACCTCAAACCGG + Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1079489224 11:20968844-20968866 GGCCCATAAAAACCTCCCACTGG - Intronic
1080885101 11:36360463-36360485 ACCCAATAAAAACCCAAAACAGG + Intronic
1087350313 11:97022881-97022903 TGCCAATGAAAACCATAAACAGG + Intergenic
1088892030 11:114052334-114052356 GGCCCATAAAAACTCCCAAGTGG - Intergenic
1091742158 12:2967006-2967028 CGCCCATAAAAACGAGAAACAGG - Intronic
1093264830 12:16990552-16990574 TCCCCAAAAAAACCATAAACTGG - Intergenic
1093721660 12:22449889-22449911 TGCCTATAAGAACAACAAACAGG + Exonic
1095548794 12:43407997-43408019 AGTCAATAAAAACTCCAAACAGG - Intronic
1101124320 12:101615326-101615348 TTCCCATAAAGACTCCAAAGTGG + Intronic
1101832751 12:108272077-108272099 TGACCATAAAAACCACAGAGGGG - Intergenic
1102926752 12:116832489-116832511 TATTCATAAAATCCCCAAACTGG - Intronic
1103586564 12:121960692-121960714 TGTCCAGGTAAACCCCAAACAGG - Exonic
1103674504 12:122644912-122644934 TGCCTATAAAAACCCGAGACCGG - Intergenic
1103833855 12:123803217-123803239 TGAAAATAAAAACCCCAAAGTGG - Intronic
1103995970 12:124830402-124830424 TACCCATAACAGCCCAAAACTGG + Intronic
1105790459 13:23793148-23793170 TATTCATAAAAGCCCCAAACTGG + Intronic
1107334548 13:39340134-39340156 TGTTCATAATAACCCTAAACTGG - Intergenic
1107962088 13:45567669-45567691 TGCTGATAAAAACCCAAGACTGG - Intronic
1108665608 13:52627070-52627092 TACTCATAATAGCCCCAAACTGG - Intergenic
1109083824 13:57943910-57943932 TGCACATAAAAGCCCCAAACTGG + Intergenic
1113217867 13:108063334-108063356 TTCCCAGAAAAAACCCCAACTGG - Intergenic
1113268281 13:108643723-108643745 TACTCATAATAGCCCCAAACTGG - Intronic
1113390946 13:109896059-109896081 TGCTGATAAAAAAACCAAACAGG + Intergenic
1114161901 14:20177820-20177842 TACCCCTAACAGCCCCAAACTGG + Intergenic
1115019506 14:28659283-28659305 TGCCCATCAAAACCCAAATGAGG + Intergenic
1116558328 14:46342445-46342467 TGTGCATAAAATCACCAAACTGG + Intergenic
1117012658 14:51486443-51486465 TGCACATAAAAACTCTACACAGG - Intergenic
1117055010 14:51903039-51903061 TGAGGATAAATACCCCAAACAGG - Intronic
1117882838 14:60328613-60328635 TGCCCATCCCAAGCCCAAACTGG - Intergenic
1120349993 14:83342850-83342872 AGTCCATAAAAACCCAGAACAGG + Intergenic
1121519142 14:94573933-94573955 CCTCCATAAAAACCCCAAAAAGG - Intronic
1121958098 14:98232753-98232775 TATTCATAATAACCCCAAACTGG + Intergenic
1122356796 14:101127525-101127547 TGCCCACAACAACCCCAGGCAGG + Intergenic
1123972798 15:25524708-25524730 TATCCATAATTACCCCAAACTGG + Intergenic
1124706074 15:31965781-31965803 TATTCATAATAACCCCAAACTGG + Intergenic
1125909289 15:43421686-43421708 TTCCCACACAAACCCAAAACAGG + Intronic
1127641637 15:60921249-60921271 TATTCATAAAAACCCCAAAATGG + Intronic
1129013911 15:72448839-72448861 TGTTCATAATAGCCCCAAACTGG + Intergenic
1129774542 15:78227701-78227723 TACTCATAAAATCCTCAAACTGG + Intronic
1130179931 15:81615414-81615436 TATCTATAAGAACCCCAAACTGG - Intergenic
1130392141 15:83466302-83466324 TATTCATAATAACCCCAAACTGG - Intronic
1130852846 15:87814595-87814617 TATTCATAATAACCCCAAACTGG + Intergenic
1132097287 15:98997159-98997181 AGCCCATGAAAGCCCCAAGCTGG + Intronic
1134076712 16:11297098-11297120 TGCTCCTAATAATCCCAAACTGG + Intronic
1134901858 16:17945349-17945371 TACTCATAATAGCCCCAAACTGG + Intergenic
1135110268 16:19685461-19685483 TACTCATAATAGCCCCAAACTGG - Intronic
1135711503 16:24721331-24721353 TACTCATAATAGCCCCAAACTGG + Intergenic
1140389395 16:74572208-74572230 ACTCCATAAAAACCCCAAAGGGG + Intronic
1140463012 16:75156580-75156602 TGCCAATAACCTCCCCAAACGGG - Intronic
1142219061 16:88844150-88844172 TTACAATAAAAACCCCAAGCAGG + Intronic
1142800459 17:2341906-2341928 TATCCATAACAGCCCCAAACTGG + Intronic
1144502222 17:15798578-15798600 TGGCCATAAAAATCCCACATGGG + Intergenic
1145071568 17:19813900-19813922 TTCCCATCAAAATCCCAAAATGG + Intronic
1145164402 17:20601238-20601260 TGGCCATAAAAATCCCACATGGG + Intergenic
1147749768 17:42723073-42723095 TGGCCAAAAAAACCTCAAATGGG + Intronic
1148331829 17:46818116-46818138 TGCCCATGAAGACCCCAAAATGG + Intronic
1148908734 17:50928319-50928341 TGCCCATAATACCCCCAGATGGG + Intergenic
1149799711 17:59556170-59556192 TGCACATAATCACCCAAAACTGG + Intergenic
1151338594 17:73455609-73455631 AGCACTTAAAAAACCCAAACAGG - Intronic
1151473440 17:74331875-74331897 TCCCCATTAAAAATCCAAACCGG - Intronic
1152051384 17:77981240-77981262 TTCTCATAAAAACCCAAAAGGGG - Intergenic
1152138345 17:78520824-78520846 TTCCTATAAAAACCCCAATAAGG + Intronic
1154071413 18:11155544-11155566 AGCACACAAAAACCCCAAAGTGG - Intergenic
1159027141 18:63194116-63194138 ATCCCATATAAACCACAAACAGG + Intronic
1159227078 18:65553697-65553719 TACTCATAATAACCCCAAACTGG + Intergenic
1160671619 19:367406-367428 TAACCAAAAAAACCCCAAAAGGG + Intronic
1164619364 19:29685119-29685141 TATTCATAACAACCCCAAACTGG - Intergenic
1165085464 19:33343180-33343202 TGTTCATAATAGCCCCAAACTGG + Intergenic
1165165964 19:33856686-33856708 TACTCATAAAAACCAAAAACTGG + Intergenic
1167322452 19:48805557-48805579 AGCCAATCCAAACCCCAAACGGG - Intronic
1167876722 19:52420159-52420181 AGTCCATAAAAACCCCAATACGG - Intergenic
926110002 2:10176201-10176223 TGCCCAAAAAAACTGAAAACAGG - Intronic
927259193 2:21069845-21069867 GGCCAATAAAAGCCCCCAACAGG + Intergenic
927905920 2:26856560-26856582 TGTCCATGAAAGCCCCAAACCGG - Intronic
928030599 2:27775253-27775275 TGCACATAAAATCCAGAAACAGG - Intronic
929903564 2:46026820-46026842 TTTCTATAAAACCCCCAAACAGG + Intronic
931504286 2:62907063-62907085 TATCCATAAGAGCCCCAAACAGG - Intronic
932409387 2:71536248-71536270 TGCCCATGACACCCCCAACCAGG + Intronic
932602467 2:73137576-73137598 TATTCATAATAACCCCAAACAGG - Intronic
932783866 2:74582354-74582376 TAATAATAAAAACCCCAAACGGG + Intronic
934863524 2:97785450-97785472 TGCAAATAAAAACCACAAAGAGG + Intronic
936683050 2:114797087-114797109 TGCCCACAAGAATACCAAACTGG + Intronic
938420950 2:131146277-131146299 TGCCCAACAAAAGCCCAAAAAGG - Intronic
939607865 2:144274559-144274581 CCTCCATAAAAACCCCAAAGGGG + Intronic
940677769 2:156746234-156746256 TGGCAACTAAAACCCCAAACAGG + Intergenic
941743919 2:169066161-169066183 AGCCCAGAACAACCCAAAACAGG + Intronic
943144896 2:184030691-184030713 TGTGCATAAAAACACCAACCAGG - Intergenic
943596222 2:189860503-189860525 TACTCATAATAGCCCCAAACTGG - Intronic
944560193 2:200928511-200928533 TGCCAATAAAAGCCCTAAAAAGG + Intronic
945433667 2:209794877-209794899 TGCTGATAAATACCCCAAACTGG - Intronic
945675845 2:212854890-212854912 TGGTCATAAAAATGCCAAACAGG - Intergenic
947192175 2:227518223-227518245 TACTGATAATAACCCCAAACTGG - Intronic
947548195 2:231027199-231027221 CCTCTATAAAAACCCCAAACGGG + Intergenic
948774532 2:240276876-240276898 TTCCCACAGAAACACCAAACTGG + Intergenic
1168991368 20:2098643-2098665 TTCCCATAAGAATTCCAAACTGG - Intergenic
1169578980 20:6997561-6997583 AGCCTGTAAATACCCCAAACTGG - Intergenic
1169612623 20:7399421-7399443 TGACCATAAAAAGCCCACATTGG + Intergenic
1169710342 20:8554322-8554344 TATTCATAAAAACCCCAAACTGG + Intronic
1170367435 20:15613302-15613324 TGCCAATAAAGACCCCAATCAGG - Intronic
1171964968 20:31523025-31523047 TCCCAAAAAAAACCCCAAACAGG - Intronic
1172194223 20:33081182-33081204 TTCCAACAAAAACACCAAACTGG - Intronic
1174448578 20:50606621-50606643 AGCCCATAGGAACCTCAAACAGG + Intronic
1174974932 20:55321369-55321391 TGTTCATAATAACCCCAAAATGG - Intergenic
1175584711 20:60129324-60129346 TGTCTATAATAACCCCAAACTGG + Intergenic
1176004106 20:62850467-62850489 TTCCCATCACAACCCCCAACTGG + Intronic
1177549674 21:22604043-22604065 TGGCCATAAAACCTCCAAAGAGG + Intergenic
1178616182 21:34135171-34135193 TACCTATAACAACCCCAAACTGG - Intronic
1179433394 21:41341753-41341775 TGTTCATAATAACCCCAAACTGG - Intronic
1182175161 22:28278239-28278261 TTCCCATAAAAACCCAGAGCAGG - Intronic
1182385957 22:29941330-29941352 TACTCATAACAGCCCCAAACTGG - Intronic
1183725012 22:39583722-39583744 TGCCCAGAAAAAACCCATATTGG + Intronic
1185152484 22:49172329-49172351 ATCCCATAATAACCTCAAACTGG - Intergenic
952764583 3:36943954-36943976 TGCCCAGAAACACCCCGATCTGG + Intronic
952985966 3:38783628-38783650 TGCCCATAAAAACCCCAAACCGG - Intronic
953150679 3:40321506-40321528 TGCCACTAGAAACCCCAAAGTGG + Intergenic
954191728 3:48967374-48967396 TGATGATAAAAACCCCAATCAGG - Intronic
955571858 3:60315718-60315740 TATTCATAAAAGCCCCAAACTGG - Intronic
955764814 3:62331526-62331548 TGGACATAAAAAGCTCAAACAGG - Intronic
957586557 3:82139574-82139596 TACCCATAAAAGCCCCAGAGTGG - Intergenic
959180963 3:102980075-102980097 TTCCCATAAAAATCCCACATGGG - Intergenic
960192164 3:114719541-114719563 TGCCCCTAATAACCCAATACTGG - Intronic
960336337 3:116421994-116422016 TCCTCATAACAGCCCCAAACTGG + Intronic
960710648 3:120524423-120524445 TACTCATAAATGCCCCAAACTGG + Intergenic
961414845 3:126749736-126749758 TGCCCATAAAAGAGCCAAACGGG - Intronic
961669150 3:128516177-128516199 TATTCATAATAACCCCAAACAGG + Intergenic
962784694 3:138757103-138757125 TGCACATAAAAACCACAATGAGG + Intronic
963029418 3:140952943-140952965 TGAACATAAAACCCACAAACAGG - Intronic
963171850 3:142259223-142259245 TGCCAATAAAAACCCAAAGGAGG + Intergenic
963327194 3:143875807-143875829 TACCCAAATAAACCTCAAACTGG + Intergenic
964655582 3:159062989-159063011 TGCCCATAAGAACCCTAAGAGGG - Intronic
968939175 4:3629166-3629188 TCCCCTTAAAAACCCCAGCCCGG + Intergenic
969216784 4:5729487-5729509 TTGCCATAAAACCCTCAAACAGG - Intronic
969218297 4:5741147-5741169 TGTTCATAATAGCCCCAAACTGG + Intronic
969327571 4:6452679-6452701 CCCTCATCAAAACCCCAAACTGG - Intronic
969692078 4:8709303-8709325 TTGCCATAATAACCACAAACTGG - Intergenic
971168345 4:24207341-24207363 TACCCATACAAACACAAAACAGG + Intergenic
971772315 4:30912745-30912767 TGCCAATAAAATCCCCATAAAGG + Intronic
971892150 4:32538635-32538657 GGCCCATAAAAACAGAAAACTGG - Intergenic
972750698 4:41985803-41985825 TGCACATAAAGTCCCTAAACAGG + Exonic
975783266 4:77861726-77861748 TACCCATAAAAAGCTCAGACTGG + Intergenic
976360082 4:84167635-84167657 TCCCCACAGAAACCCCACACTGG + Intergenic
977507867 4:97924396-97924418 TGCCCCTAAAAACTCCCAATGGG + Intronic
978125439 4:105130167-105130189 TGTCTAAAAAAACCTCAAACAGG + Intergenic
979208314 4:118069467-118069489 TAGACAAAAAAACCCCAAACAGG - Intronic
979821682 4:125181769-125181791 TACTCATAATAACCCAAAACTGG + Intergenic
980194791 4:129574539-129574561 TGCACATAAATGCCCCAAATGGG + Intergenic
982359775 4:154506858-154506880 TGACAATACAAACCCAAAACAGG + Intergenic
982487643 4:155986677-155986699 TACTCATAATAGCCCCAAACTGG - Intergenic
983530006 4:168800828-168800850 TGCTCATAATAACCCCAAACTGG + Intronic
985870598 5:2551929-2551951 TATCCATAACAGCCCCAAACTGG - Intergenic
986028823 5:3876092-3876114 TCCACACAAACACCCCAAACAGG - Intergenic
986280964 5:6322050-6322072 TGCCCATACAAAACCAACACAGG + Intergenic
986789232 5:11144129-11144151 TGCTCATAGAAACCCCTAGCTGG - Intronic
987540902 5:19253957-19253979 TGAACATATAAATCCCAAACTGG + Intergenic
988521989 5:31954624-31954646 TTCCCATAAAAACCACTAAGAGG + Intronic
989530137 5:42498441-42498463 TCCCCATAAAAACCCTACAAGGG + Intronic
990335243 5:54765979-54766001 TCCCCATAAAAACCCCTAAGAGG + Intergenic
990618582 5:57534041-57534063 TGTTCATAAAAGCCCAAAACCGG - Intergenic
996338769 5:122413193-122413215 GGCCAATAAAATCCCCAAATGGG + Intronic
996373814 5:122781432-122781454 TATTCATAAATACCCCAAACTGG - Intronic
997460189 5:134046677-134046699 TGCCCAAAACAACCCAGAACTGG - Intergenic
1001069902 5:168576787-168576809 TGCCAAAAAAAACCCCATACAGG + Intronic
1001377004 5:171269510-171269532 TGCTAATAATAACCCCCAACTGG - Intronic
1001775889 5:174328859-174328881 TGCCCAGACATATCCCAAACAGG - Intergenic
1002005887 5:176234547-176234569 TGCCCAGAAAAACTGAAAACGGG - Intergenic
1002220490 5:177676080-177676102 TGCCCAGAAAAACTGAAAACGGG + Intergenic
1003527816 6:6912607-6912629 TTCTCATAAAAACACCAAAGAGG + Intergenic
1004686145 6:17946763-17946785 TGTTCATAAAAGCCCCAAACTGG + Intronic
1004982787 6:21045185-21045207 TGACCATAAAAACCCAAAGAAGG - Intronic
1005138929 6:22604198-22604220 CCTCTATAAAAACCCCAAACTGG - Intergenic
1005694127 6:28335717-28335739 AGTCCATAAAAACCCCAGAACGG + Intronic
1006172961 6:32105845-32105867 AGCTCATAATAGCCCCAAACTGG + Intronic
1006230574 6:32583017-32583039 TCCACATACAAACCACAAACTGG + Intronic
1006704098 6:36002300-36002322 TGTTCATAATAGCCCCAAACTGG - Intronic
1006935794 6:37716687-37716709 AGACCATACCAACCCCAAACAGG - Intergenic
1008067723 6:47068288-47068310 TGTTCATAATAACCCAAAACTGG + Intergenic
1014486005 6:121999966-121999988 TGCCCACTAAAACCACAAATGGG - Intergenic
1014804792 6:125817183-125817205 TGTTCATAAATAGCCCAAACTGG - Intronic
1015367537 6:132413873-132413895 TGCCTATAGAAACTCCAAAGGGG - Intergenic
1015437290 6:133203715-133203737 ATCCAAAAAAAACCCCAAACAGG - Intergenic
1016399030 6:143658063-143658085 TGTTCATAATAGCCCCAAACTGG - Intronic
1018060805 6:160088204-160088226 TGCCCATGAAAACCCCAAGGAGG - Intronic
1019848390 7:3528856-3528878 AGCCCATAAAAAGCCCAAATGGG - Intronic
1020030175 7:4927130-4927152 TCTCCATAATATCCCCAAACAGG - Intronic
1020492464 7:8804877-8804899 TACTCACAATAACCCCAAACTGG + Intergenic
1021717138 7:23470511-23470533 TCCCCATAAAAAACCCAGAAGGG + Intergenic
1022869199 7:34457940-34457962 GGCCGATAAAAACCTCATACAGG + Intergenic
1023664608 7:42509999-42510021 TGTCCATAATAGCCCCTAACTGG + Intergenic
1026166945 7:67918607-67918629 TGCCCATGAAAACCCAGAAATGG - Intergenic
1027847460 7:83400121-83400143 TGCCCATAAAAAACCAATATTGG - Exonic
1028506193 7:91572750-91572772 TTCCCATAGAAACACTAAACTGG - Intergenic
1030307813 7:108036697-108036719 TGCTCATAAAAACATCAACCTGG + Intronic
1030791381 7:113732907-113732929 TGTTCATAATAGCCCCAAACTGG - Intergenic
1033216386 7:139496373-139496395 TGCCCCTATTAACCCAAAACTGG + Intergenic
1033435179 7:141327207-141327229 TGCCCAGAAAAATCCCATAATGG + Intronic
1033798899 7:144878290-144878312 CTTCCATAAAAACCCCAAATGGG - Intergenic
1038398456 8:27264763-27264785 TATTCATAATAACCCCAAACTGG + Intergenic
1039421686 8:37448735-37448757 TGTCCATAAGGGCCCCAAACTGG + Intergenic
1042204674 8:66317177-66317199 TACTCATAATAGCCCCAAACTGG + Intergenic
1042420178 8:68579330-68579352 TGCAGATAGAAACACCAAACAGG + Intronic
1044550027 8:93501663-93501685 TCTTCATAAAATCCCCAAACTGG + Intergenic
1049118198 8:140708642-140708664 CCCCCAAAAACACCCCAAACAGG + Intronic
1049295493 8:141832319-141832341 TATCCATAACAGCCCCAAACTGG - Intergenic
1050074616 9:1850481-1850503 TGTCCAGAAAAACACCAAAATGG - Intergenic
1052103234 9:24477240-24477262 TATACATAATAACCCCAAACTGG + Intergenic
1054451574 9:65406155-65406177 TCCCCTTAAAAACCCCAGCCTGG - Intergenic
1054803284 9:69374287-69374309 TGTTCATAATACCCCCAAACTGG - Intronic
1055960112 9:81812359-81812381 TGCCCATGATAGCCCCAAATTGG + Intergenic
1059546888 9:115185068-115185090 TATCCATAATAACCCAAAACTGG - Intronic
1059832650 9:118115650-118115672 TGTTTATAAAAACCCCAAACTGG + Intergenic
1060798029 9:126525838-126525860 TGCTCATAAGAACCAGAAACCGG + Intergenic
1187568851 X:20480451-20480473 TCTTCATAAAACCCCCAAACTGG + Intergenic
1187968545 X:24636977-24636999 TATTCATAATAACCCCAAACTGG - Intronic
1189835636 X:45018766-45018788 TGCCAATAAAAAACCCAGGCAGG - Intronic
1189933632 X:46041297-46041319 TGTCCATAAAAGCCCAAAATTGG - Intergenic
1196282661 X:113840923-113840945 AGCCCATAAGAAGCCAAAACAGG - Intergenic
1196400279 X:115308821-115308843 TCCCAATAAAAACTCTAAACAGG + Intergenic
1201499229 Y:14624154-14624176 TTCAGAGAAAAACCCCAAACAGG + Intronic
1201510213 Y:14751206-14751228 AGTCCATAATAACCTCAAACTGG - Intronic