ID: 952989636

View in Genome Browser
Species Human (GRCh38)
Location 3:38820617-38820639
Sequence TAGGTATCACCATGAATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952989636_952989637 -8 Left 952989636 3:38820617-38820639 CCAGTTATTCATGGTGATACCTA No data
Right 952989637 3:38820632-38820654 GATACCTAGTGTTCTGTCGTAGG No data
952989636_952989639 0 Left 952989636 3:38820617-38820639 CCAGTTATTCATGGTGATACCTA No data
Right 952989639 3:38820640-38820662 GTGTTCTGTCGTAGGTTCCAAGG No data
952989636_952989641 23 Left 952989636 3:38820617-38820639 CCAGTTATTCATGGTGATACCTA No data
Right 952989641 3:38820663-38820685 CTGTGTATGTAAAATGTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952989636 Original CRISPR TAGGTATCACCATGAATAAC TGG (reversed) Intergenic