ID: 952989637

View in Genome Browser
Species Human (GRCh38)
Location 3:38820632-38820654
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952989636_952989637 -8 Left 952989636 3:38820617-38820639 CCAGTTATTCATGGTGATACCTA No data
Right 952989637 3:38820632-38820654 GATACCTAGTGTTCTGTCGTAGG No data
952989631_952989637 21 Left 952989631 3:38820588-38820610 CCCATGCAAGTGGCCTAATTCCT No data
Right 952989637 3:38820632-38820654 GATACCTAGTGTTCTGTCGTAGG No data
952989633_952989637 8 Left 952989633 3:38820601-38820623 CCTAATTCCTTTAGTGCCAGTTA No data
Right 952989637 3:38820632-38820654 GATACCTAGTGTTCTGTCGTAGG No data
952989634_952989637 1 Left 952989634 3:38820608-38820630 CCTTTAGTGCCAGTTATTCATGG No data
Right 952989637 3:38820632-38820654 GATACCTAGTGTTCTGTCGTAGG No data
952989632_952989637 20 Left 952989632 3:38820589-38820611 CCATGCAAGTGGCCTAATTCCTT No data
Right 952989637 3:38820632-38820654 GATACCTAGTGTTCTGTCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type