ID: 952989638

View in Genome Browser
Species Human (GRCh38)
Location 3:38820636-38820658
Sequence GGAACCTACGACAGAACACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952989638_952989641 4 Left 952989638 3:38820636-38820658 CCTAGTGTTCTGTCGTAGGTTCC No data
Right 952989641 3:38820663-38820685 CTGTGTATGTAAAATGTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952989638 Original CRISPR GGAACCTACGACAGAACACT AGG (reversed) Intergenic
No off target data available for this crispr