ID: 952989639

View in Genome Browser
Species Human (GRCh38)
Location 3:38820640-38820662
Sequence GTGTTCTGTCGTAGGTTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952989632_952989639 28 Left 952989632 3:38820589-38820611 CCATGCAAGTGGCCTAATTCCTT No data
Right 952989639 3:38820640-38820662 GTGTTCTGTCGTAGGTTCCAAGG No data
952989634_952989639 9 Left 952989634 3:38820608-38820630 CCTTTAGTGCCAGTTATTCATGG No data
Right 952989639 3:38820640-38820662 GTGTTCTGTCGTAGGTTCCAAGG No data
952989636_952989639 0 Left 952989636 3:38820617-38820639 CCAGTTATTCATGGTGATACCTA No data
Right 952989639 3:38820640-38820662 GTGTTCTGTCGTAGGTTCCAAGG No data
952989633_952989639 16 Left 952989633 3:38820601-38820623 CCTAATTCCTTTAGTGCCAGTTA No data
Right 952989639 3:38820640-38820662 GTGTTCTGTCGTAGGTTCCAAGG No data
952989631_952989639 29 Left 952989631 3:38820588-38820610 CCCATGCAAGTGGCCTAATTCCT No data
Right 952989639 3:38820640-38820662 GTGTTCTGTCGTAGGTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952989639 Original CRISPR GTGTTCTGTCGTAGGTTCCA AGG Intergenic
No off target data available for this crispr