ID: 952989641

View in Genome Browser
Species Human (GRCh38)
Location 3:38820663-38820685
Sequence CTGTGTATGTAAAATGTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952989638_952989641 4 Left 952989638 3:38820636-38820658 CCTAGTGTTCTGTCGTAGGTTCC No data
Right 952989641 3:38820663-38820685 CTGTGTATGTAAAATGTCATAGG No data
952989636_952989641 23 Left 952989636 3:38820617-38820639 CCAGTTATTCATGGTGATACCTA No data
Right 952989641 3:38820663-38820685 CTGTGTATGTAAAATGTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952989641 Original CRISPR CTGTGTATGTAAAATGTCAT AGG Intergenic
No off target data available for this crispr