ID: 952990878

View in Genome Browser
Species Human (GRCh38)
Location 3:38829679-38829701
Sequence CCCCATGCGCTGCTTTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952990878_952990888 29 Left 952990878 3:38829679-38829701 CCTCTGCAAAGCAGCGCATGGGG No data
Right 952990888 3:38829731-38829753 GTAGAGAAGGGATCTGAATGAGG No data
952990878_952990887 17 Left 952990878 3:38829679-38829701 CCTCTGCAAAGCAGCGCATGGGG No data
Right 952990887 3:38829719-38829741 CAGCATAGCGGTGTAGAGAAGGG No data
952990878_952990882 5 Left 952990878 3:38829679-38829701 CCTCTGCAAAGCAGCGCATGGGG No data
Right 952990882 3:38829707-38829729 AGCTGGACCCCTCAGCATAGCGG No data
952990878_952990886 16 Left 952990878 3:38829679-38829701 CCTCTGCAAAGCAGCGCATGGGG No data
Right 952990886 3:38829718-38829740 TCAGCATAGCGGTGTAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952990878 Original CRISPR CCCCATGCGCTGCTTTGCAG AGG (reversed) Intergenic
No off target data available for this crispr