ID: 952996181

View in Genome Browser
Species Human (GRCh38)
Location 3:38884678-38884700
Sequence CTATATCCACTCAAGGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952996178_952996181 -6 Left 952996178 3:38884661-38884683 CCTATAGGAAAAAGCCACTATAT 0: 1
1: 0
2: 0
3: 14
4: 165
Right 952996181 3:38884678-38884700 CTATATCCACTCAAGGAATTAGG 0: 1
1: 0
2: 0
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952996181 Original CRISPR CTATATCCACTCAAGGAATT AGG Intronic
906217501 1:44051970-44051992 CTCTATCCACTCAATGAAAGAGG - Intergenic
907023860 1:51095508-51095530 CTATGTTCACTCAAGGCCTTAGG - Intergenic
909715835 1:78705172-78705194 CTATATCCACTCAGGCAAAATGG - Intergenic
911343903 1:96673854-96673876 CTATATTCACTCAAGGCCCTAGG + Intergenic
911666092 1:100554356-100554378 CTTTATCCACTCATTGAAATGGG + Intergenic
911791620 1:102023360-102023382 ATATATCCACTTAAACAATTTGG + Intergenic
912591966 1:110831392-110831414 GTTTATCCACTCGGGGAATTTGG - Intergenic
913083645 1:115413689-115413711 CTATTTCCACATAAGGAAATTGG - Intergenic
913361799 1:117989323-117989345 CTACTTCCACTCATGGAAATGGG + Intronic
914370258 1:147018579-147018601 CTTTATACTGTCAAGGAATTGGG + Intergenic
914484436 1:148094834-148094856 CTTTATACTGTCAAGGAATTGGG - Intergenic
916254320 1:162770870-162770892 CTTTACCCACTCATGAAATTTGG - Intronic
919179626 1:194063441-194063463 TTCTATCCACTCAAATAATTTGG - Intergenic
921484509 1:215699988-215700010 CTAAAACCACTCAATAAATTAGG - Intronic
921492945 1:215801096-215801118 ATAAATCCACTCAAGAAAATAGG + Intronic
924062386 1:240188498-240188520 CTATATCCAGCCAAAGAGTTGGG + Intronic
924237220 1:242009436-242009458 TTATATCCTGGCAAGGAATTTGG - Intergenic
924653597 1:245951937-245951959 ATATATTCACTAAAGGAATCAGG + Intronic
1064369572 10:14739367-14739389 CTATACCCACTCAATGAGTAGGG + Intronic
1064987420 10:21225395-21225417 CTATGTTCACTCAAGGACCTAGG + Intergenic
1066525795 10:36277767-36277789 CTGTATGCAGTTAAGGAATTTGG + Intergenic
1068996942 10:63217307-63217329 CTGTATCCATTTAAGGAATAAGG + Exonic
1070059293 10:72967085-72967107 CTATGTTCACTCAAGGACCTAGG + Intergenic
1071978359 10:90977852-90977874 CTATCTCCACTCCCTGAATTTGG + Intergenic
1075497454 10:122937146-122937168 CTATATCTACTTAAGCAATTAGG + Intronic
1078351449 11:10598082-10598104 CTATATCCTCAGATGGAATTTGG - Intronic
1082266715 11:50127110-50127132 CTATATCTGCTCAAGACATTAGG - Intergenic
1082289374 11:50351458-50351480 CTATATCTGCTCAAGACATTAGG + Intergenic
1082672377 11:56051189-56051211 CTATATGCCCTCAAGGAGGTTGG - Intergenic
1086542445 11:87929418-87929440 GTATATCCACACCAGGAAATAGG - Intergenic
1087969554 11:104462483-104462505 CCATATCCACGCAAGGGGTTGGG + Intergenic
1089311057 11:117558420-117558442 CAATAGCCACCCAAGGAAGTTGG + Intronic
1090318201 11:125816727-125816749 CTATGTTCACTCAAGGACCTGGG + Intergenic
1092865033 12:12752929-12752951 CTATCTCCACTCAAGAAAAATGG + Intronic
1095099454 12:38165529-38165551 CTATGTTCACTCAAGGCCTTTGG + Intergenic
1095133736 12:38572580-38572602 CTATATTCACTCAAGGCCCTGGG - Intergenic
1096487868 12:51995831-51995853 CAAAAACCACTCAAGGAATTGGG - Intronic
1097644483 12:62220396-62220418 CTATATCCTCACCAGGATTTGGG - Intronic
1099376295 12:81899108-81899130 CTGTAGCCACTCAAGGAAGGTGG - Intergenic
1100236433 12:92666432-92666454 CTATAACCACTCACTGAACTTGG + Intergenic
1106703378 13:32254098-32254120 AAATACCCACTGAAGGAATTAGG + Intronic
1109290243 13:60465100-60465122 CTATTCCCACAAAAGGAATTAGG - Intronic
1114072573 14:19126513-19126535 CTATATTCACTCAAGGCCCTGGG + Intergenic
1114089683 14:19273459-19273481 CTATATTCACTCAAGGCCCTGGG - Intergenic
1115780439 14:36762748-36762770 CTATACCAACTCAAGGAGATGGG - Intronic
1116030183 14:39561663-39561685 CTATCCCCACTCAAGGCAATGGG - Intergenic
1126216341 15:46158498-46158520 CTATGTTCACTCAAGGACCTGGG - Intergenic
1127853820 15:62938604-62938626 CTCTGTACACTGAAGGAATTGGG - Intergenic
1127937394 15:63655025-63655047 CTGTAACCAGTCAAGGAACTGGG + Intronic
1131348171 15:91670961-91670983 CTTTACCCACTCATGGAAATGGG + Intergenic
1134360723 16:13528738-13528760 CTTTATCAACTCAATTAATTAGG - Intergenic
1140619732 16:76715976-76715998 CTATATCTATTTAAGGAAGTAGG + Intergenic
1146216676 17:30982053-30982075 CTATATTGACTCAAGGACCTAGG + Intronic
1146639388 17:34528367-34528389 ATATATCGATTCATGGAATTAGG + Intergenic
1148006670 17:44437200-44437222 TTAAATCCACTCTAGGAAATGGG - Intronic
1153063036 18:1013741-1013763 CAAAACCCACTCAAAGAATTAGG - Intergenic
1153467802 18:5408573-5408595 CTATATACATTCAAGAAAATTGG - Intronic
1155244735 18:23896599-23896621 CTATTTCCCCTCAGGGAAATAGG - Intronic
1156924898 18:42564332-42564354 CAATATCATCTCAAGGACTTGGG + Intergenic
1158024906 18:52885167-52885189 CTATGTTCACTCAAGGATGTAGG + Intronic
1158436602 18:57438719-57438741 CTAAATCCACTCAAAGTATCCGG - Intronic
1158948920 18:62474218-62474240 CTATATTCACTCAAGGCCCTAGG + Intergenic
1161598193 19:5163261-5163283 CTATAGCCACTCGAGGAAGGCGG + Intronic
1166576802 19:43848477-43848499 CTTTATCAACGTAAGGAATTCGG + Exonic
1166801147 19:45458012-45458034 CTACAACCACTCCAGGCATTGGG - Intronic
1167273910 19:48523358-48523380 CTATATGCTCTCAAAGAACTTGG + Intergenic
928824308 2:35400599-35400621 CTTTATCCACTCATTGATTTGGG + Intergenic
928862378 2:35874643-35874665 CTATATTCACTCAAGGCCCTCGG + Intergenic
931572355 2:63681670-63681692 CTATATTCACTCAAGGCCTTGGG - Intronic
935344753 2:102096159-102096181 CATTTTCCACTCAATGAATTTGG + Intronic
938783125 2:134603193-134603215 CAAAATCCACTCAAGGACCTGGG + Intronic
939403287 2:141722892-141722914 CTACAGCTACTAAAGGAATTGGG - Intronic
940723961 2:157313708-157313730 GTATATCAACTAAAGGAAGTTGG + Exonic
945222367 2:207497906-207497928 CTTTATCCACTTAAGGACTCAGG + Intergenic
946006015 2:216525583-216525605 CTATAGCCACTCAACAAATGGGG - Intronic
1170173702 20:13443364-13443386 CTATATCCACAGAGGGAACTGGG + Intronic
1170382972 20:15782036-15782058 CTATATCGAGTCGATGAATTGGG + Intronic
1171779501 20:29406203-29406225 CTATGTTCACTCAAGGCCTTTGG - Intergenic
1171820661 20:29834774-29834796 CTATGTTCACTCAAGGCCTTTGG - Intergenic
1171897166 20:30818395-30818417 CTATGTACACTCAAGGCCTTTGG + Intergenic
1174804994 20:53597458-53597480 CTAAATGCACTCAAGTAAGTAGG + Intronic
1174955429 20:55092610-55092632 CAATATCAAAACAAGGAATTTGG + Intergenic
1175367263 20:58464665-58464687 CTATATCCAGGCAATGAATTTGG + Intronic
1177135097 21:17299445-17299467 CTGTAGCCACTCAAGGAAGGTGG - Intergenic
1177724135 21:24945248-24945270 CTATTTCTAGTCCAGGAATTAGG + Intergenic
1177741115 21:25154747-25154769 CTATATGCAGTCTAGGGATTTGG + Intergenic
1177849923 21:26333720-26333742 CTATATTCACTCAAGACCTTAGG - Intergenic
1178704014 21:34858125-34858147 CTCCATCCACTCAAGGACTTTGG + Intronic
1180324694 22:11359723-11359745 CTATGTTCACTCAAGGCCTTTGG - Intergenic
1180491021 22:15848888-15848910 CTATATTCACTCAAGGCCCTGGG + Intergenic
1185120100 22:48960897-48960919 CTGTAACCACTTAAGGAAGTGGG - Intergenic
952203670 3:31157424-31157446 CTTTATCCACTCACTGATTTAGG - Intergenic
952996181 3:38884678-38884700 CTATATCCACTCAAGGAATTAGG + Intronic
955610949 3:60756699-60756721 CTAAAACAACTCTAGGAATTAGG + Intronic
957085644 3:75674449-75674471 CTATGTTCACTCAAGGCCTTTGG + Intergenic
958500512 3:94901186-94901208 CCATATCTTCACAAGGAATTTGG + Intergenic
958642698 3:96828291-96828313 TTATCTCCTCTGAAGGAATTAGG - Intronic
958756802 3:98259657-98259679 CTATTTTCACTCAAGGCCTTGGG + Intergenic
958847273 3:99279464-99279486 CTATGTTCACTCAAGGACCTGGG - Intergenic
959260531 3:104073875-104073897 CTATATCTACTTTAGAAATTGGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
962868548 3:139468174-139468196 CTATTTCCACTCAATGGATGTGG + Intronic
963525307 3:146408856-146408878 CTCCTTCCACTTAAGGAATTTGG + Intronic
965128728 3:164666851-164666873 CAATAAACAATCAAGGAATTTGG + Intergenic
972133274 4:35862479-35862501 CCATAGCCACTCAAGGAAGGTGG + Intergenic
980657766 4:135811955-135811977 CTATGTTCACTCAAGGACTTAGG - Intergenic
981996238 4:150978021-150978043 CTATATTCACTCAAGGCCCTAGG - Intronic
984421795 4:179532690-179532712 CTCTTTCCACTCTAAGAATTTGG - Intergenic
984475813 4:180233031-180233053 GTATACCCACTGAAGGAATGAGG + Intergenic
984831550 4:183980192-183980214 CTATATCACCTCATGGAAGTTGG - Intronic
984917470 4:184737110-184737132 CCATAGCCACTCAAGGAAGGCGG - Intergenic
985444369 4:190013076-190013098 CTATGTTCACTCAAGGCCTTTGG - Intergenic
988825942 5:34934895-34934917 ATTTCTCTACTCAAGGAATTTGG + Intronic
989421885 5:41249995-41250017 CTAAACCCACCCAAAGAATTTGG - Intronic
994343999 5:98663736-98663758 CTATGTTCACTCAAGGCCTTAGG - Intergenic
995128363 5:108602788-108602810 CTATACCCACTGAAGAATTTAGG + Intergenic
996594577 5:125185853-125185875 CTATATTCACTCAAGGCCCTGGG - Intergenic
996666645 5:126067205-126067227 CTATATTCACTCAAGGCCCTAGG - Intergenic
998984823 5:147744743-147744765 CTATATCCACACAAGGATCTGGG - Intronic
999221326 5:149980724-149980746 CTACAGCCACACTAGGAATTAGG - Exonic
1000270313 5:159677731-159677753 CTATGTTCACTCAAGGACCTGGG - Intergenic
1001177747 5:169487393-169487415 CTATGTTCACTCAAGGCCTTGGG - Intergenic
1002802773 6:541761-541783 CTATAACCATTAAAGAAATTGGG + Intronic
1003795024 6:9591643-9591665 CTAAAACCACTGAAGAAATTAGG - Intergenic
1006056249 6:31386683-31386705 CATTATGCACTCAAGGAATAGGG + Intergenic
1007030047 6:38619091-38619113 CCATAGCCACTCAAGGAAGGTGG - Intronic
1008716765 6:54297907-54297929 CTATATACTCTCAATAAATTAGG + Intergenic
1010230959 6:73534918-73534940 ATATATCCAAACAAAGAATTGGG + Intergenic
1014865165 6:126520766-126520788 CTACATTCACTCAAGGCCTTGGG + Intergenic
1015486960 6:133782789-133782811 CTGTAACAAGTCAAGGAATTTGG + Intergenic
1015959538 6:138632355-138632377 CTATGTTCACTCAAGGCCTTGGG - Intronic
1016368780 6:143348651-143348673 CTATCTCCAAAAAAGGAATTGGG + Intergenic
1019941898 7:4298414-4298436 TTACATGCACTCATGGAATTGGG - Intergenic
1023457088 7:40351433-40351455 AATAATCCACTCAAGGAATTAGG - Intronic
1024291863 7:47810871-47810893 ATATATCCACACTAGGAGTTAGG - Intronic
1028521913 7:91741768-91741790 CTATTTTCACTCAAGGCCTTAGG + Intronic
1033431618 7:141294721-141294743 CTATATTCTCTCAAGGAGTCTGG - Intronic
1037186852 8:16074911-16074933 CTACTTCCACTCAAGGAAGAAGG + Intergenic
1038670642 8:29580272-29580294 ATATGTCCACCAAAGGAATTGGG + Intergenic
1043085949 8:75833318-75833340 CTTTATCCACTCATTGATTTGGG - Intergenic
1046338024 8:112814875-112814897 CTATAATCACTCAAGGCCTTTGG + Intronic
1046987363 8:120403247-120403269 CTTTATCCAGTCTGGGAATTTGG - Intronic
1048082264 8:131141385-131141407 CTATTTTCACTCAAAGACTTTGG + Intergenic
1048406152 8:134124243-134124265 CTCCATCAACTCAATGAATTTGG + Intergenic
1048504974 8:135013007-135013029 CTATGTCCAGTCAAGGGATTTGG + Intergenic
1049447565 8:142638388-142638410 CCATCTCCGCTCCAGGAATTAGG - Intergenic
1050508321 9:6369714-6369736 CTATATTCACTCATGGCACTAGG - Intergenic
1050622135 9:7465360-7465382 ACATATCCACCAAAGGAATTGGG - Intergenic
1051227972 9:14922466-14922488 CTAGATCCACTCAAGGTAGTAGG - Intergenic
1052601776 9:30642274-30642296 CTGTTTCCACACAAGAAATTTGG - Intergenic
1053749732 9:41240215-41240237 CTATGTTCACTCAAGGCCTTTGG + Intergenic
1054255234 9:62804555-62804577 CTATGTTCACTCAAGGCCTTTGG + Intergenic
1054336074 9:63811056-63811078 CTATGTTCACTCAAGGCCTTTGG - Intergenic
1058034208 9:100233551-100233573 CTAAAACCACTCAATAAATTAGG - Intronic
1058559334 9:106208002-106208024 CTATATCAACTGAATGAAGTTGG - Intergenic
1061514553 9:131081309-131081331 CTAGATACACTGAAAGAATTTGG - Intronic
1061619058 9:131799106-131799128 GTTTATCCACTCATGGAAGTGGG - Intergenic
1203376003 Un_KI270442v1:378470-378492 CTATGTTCACTCAAGGTCTTTGG - Intergenic
1185856238 X:3538833-3538855 CTAACACCACTCAAAGAATTTGG + Intergenic
1191991147 X:67038485-67038507 CTATGTCCACTCAAGGTACAAGG + Intergenic
1193260870 X:79404647-79404669 CTATATTCACTCAAGGCCCTGGG - Intergenic
1193263933 X:79445086-79445108 TAATATCCTCACAAGGAATTGGG + Intergenic
1197885116 X:131210305-131210327 CTATTCCCAGCCAAGGAATTTGG + Intergenic
1201066025 Y:10095112-10095134 CTATGTTCACTCAAGGCCTTTGG + Intergenic
1201762502 Y:17555421-17555443 CTATGTTCACTCAAGGCCTTTGG - Intergenic
1201839050 Y:18350567-18350589 CTATGTTCACTCAAGGCCTTTGG + Intergenic
1201927746 Y:19307920-19307942 CTATATTCACTCAAGGGCTCAGG + Intergenic