ID: 952998121

View in Genome Browser
Species Human (GRCh38)
Location 3:38904951-38904973
Sequence ACCTGGGTAGAGGTGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 353}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952998121_952998131 6 Left 952998121 3:38904951-38904973 CCAGCTTCCACCTCTACCCAGGT 0: 1
1: 0
2: 1
3: 30
4: 353
Right 952998131 3:38904980-38905002 TTAGAGTGGGCCCACAGGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 183
952998121_952998130 2 Left 952998121 3:38904951-38904973 CCAGCTTCCACCTCTACCCAGGT 0: 1
1: 0
2: 1
3: 30
4: 353
Right 952998130 3:38904976-38904998 CAGTTTAGAGTGGGCCCACAGGG 0: 1
1: 0
2: 0
3: 7
4: 103
952998121_952998126 -7 Left 952998121 3:38904951-38904973 CCAGCTTCCACCTCTACCCAGGT 0: 1
1: 0
2: 1
3: 30
4: 353
Right 952998126 3:38904967-38904989 CCCAGGTGCCAGTTTAGAGTGGG 0: 1
1: 0
2: 1
3: 5
4: 120
952998121_952998124 -8 Left 952998121 3:38904951-38904973 CCAGCTTCCACCTCTACCCAGGT 0: 1
1: 0
2: 1
3: 30
4: 353
Right 952998124 3:38904966-38904988 ACCCAGGTGCCAGTTTAGAGTGG 0: 1
1: 0
2: 1
3: 8
4: 134
952998121_952998129 1 Left 952998121 3:38904951-38904973 CCAGCTTCCACCTCTACCCAGGT 0: 1
1: 0
2: 1
3: 30
4: 353
Right 952998129 3:38904975-38904997 CCAGTTTAGAGTGGGCCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952998121 Original CRISPR ACCTGGGTAGAGGTGGAAGC TGG (reversed) Intronic
900028622 1:354010-354032 ACCTGGGGAGACGTGGCTGCAGG - Intergenic
900934312 1:5755718-5755740 CCCTGGGCACAGGTGGCAGCTGG + Intergenic
901676963 1:10890941-10890963 ACTTGGGTGGAGGTGGAAATTGG + Intergenic
901706984 1:11081417-11081439 AGCTGGGTAGAATTGGAGGCAGG + Intronic
902051406 1:13566427-13566449 AGCTGGGGAGAGGTGGAGGGTGG - Intergenic
902238403 1:15072728-15072750 ACCTAGGAAGAGGTGGAACTGGG + Intronic
902311408 1:15584581-15584603 CCCCGGGTCGAGTTGGAAGCTGG - Intronic
903344603 1:22676480-22676502 TCCTAGTGAGAGGTGGAAGCTGG - Intergenic
903837022 1:26211053-26211075 ACCTGGGTAGAGGTGATTTCTGG + Intergenic
905076011 1:35270681-35270703 ACCTGGGAGGCGGTGGTAGCAGG + Intronic
905497318 1:38403083-38403105 ACAGGGGTAGAGGAAGAAGCGGG + Intergenic
906996936 1:50806493-50806515 AGTGGGGTAGTGGTGGAAGCAGG - Intronic
907579453 1:55558529-55558551 ACTTGGCCAGAGGTGGCAGCAGG - Intergenic
907662876 1:56409384-56409406 AACTGGATTGAGGTGGGAGCAGG - Intergenic
909643031 1:77888322-77888344 GCCTGGCTGGAGGTGGAGGCAGG + Intergenic
912252931 1:108029936-108029958 AAATGGGTAGATGTGGAAGTAGG + Intergenic
912551320 1:110487303-110487325 CCCTGTGCAGAGGTGGAATCGGG - Intergenic
912925537 1:113909825-113909847 ACCTGTGGGGAGGTGGAAGTGGG + Intronic
915012158 1:152697951-152697973 ACCTGCCTAGCTGTGGAAGCAGG + Intergenic
915121435 1:153631901-153631923 AAGTGGGGTGAGGTGGAAGCAGG - Exonic
915210363 1:154304182-154304204 ACCTGGGAAGTGGAGGTAGCAGG + Intergenic
915724371 1:158007329-158007351 ACCTGGGCCCAGGTGGAAGGAGG + Intronic
916425846 1:164678883-164678905 ACCTGTGTGGAGGTGCAAGAAGG + Intronic
916578959 1:166090810-166090832 ATCTGGGAAGAGGTGGATGATGG + Intronic
918078096 1:181185644-181185666 ACCTGGGAAGATGGGGAAGGTGG - Intergenic
918392782 1:184083907-184083929 ACAGGGGTAGAGGTGGAAGAGGG - Intergenic
918602016 1:186375336-186375358 AAGTGGGTGGAGCTGGAAGCCGG - Intronic
919916216 1:202141082-202141104 ACCTTGGCAGAGGGGGATGCTGG + Intronic
920008435 1:202850472-202850494 TACTGGGTAGAGGTGGAATAAGG - Intergenic
920446575 1:206022858-206022880 GGCTGGGGAGAGGTGGGAGCGGG - Intronic
920446712 1:206023508-206023530 ACCTCCGTGGAGGTGGAGGCAGG + Intronic
920506993 1:206522274-206522296 AGCTGGGTAGATGTGGAAAGAGG + Intronic
921033433 1:211353901-211353923 ACCAGGAGAGATGTGGAAGCAGG + Intronic
922700505 1:227756893-227756915 CCATGGGTTGAGGTGGGAGCAGG + Intronic
1063587532 10:7366090-7366112 ACCTTGGTGCAGGTGGAAGAGGG + Intronic
1064454707 10:15476498-15476520 CCCTGGCTACAGGTGTAAGCTGG + Intergenic
1067510364 10:46889939-46889961 CCCTGGGTATAGGTACAAGCTGG + Intergenic
1067573564 10:47389115-47389137 CCCTGGGGAGAGGAGGAAACTGG + Intergenic
1067651889 10:48161918-48161940 CCCTGGGTATAGGTACAAGCTGG - Intronic
1067768504 10:49107555-49107577 CCCTGGGTAGAGGTGGTGGTGGG - Intronic
1069824333 10:71246017-71246039 ACCTGGCTGGAGGTGGAGGTGGG + Intronic
1069996353 10:72344397-72344419 ACCTGGGGAGAAATGGGAGCTGG + Intronic
1070772600 10:79091007-79091029 AGGTGGGGAGTGGTGGAAGCAGG - Intronic
1070939770 10:80334253-80334275 GCCTGGGTAGATGTGAATGCAGG + Intergenic
1071362251 10:84860397-84860419 ACCGGGGTGGAGATGGAAGGAGG - Intergenic
1071566306 10:86673086-86673108 TCCTGGGCAGAGGTGGAGCCTGG - Intronic
1071810643 10:89177268-89177290 AGGTGGGTAGAGGTGGTAGTGGG - Intergenic
1072484631 10:95843550-95843572 ACCTGGGAAGTGGTGGAGCCAGG + Intronic
1073441588 10:103555595-103555617 AGCTGGGTAGAGCAGGAAGAGGG + Intronic
1073507546 10:104012617-104012639 ACCTGGGTAGTGGTAGAGCCAGG + Intronic
1075682816 10:124344391-124344413 TCAGGGGTAGAAGTGGAAGCAGG - Intergenic
1075946714 10:126439871-126439893 ACAGGGGTAGAGGTAGCAGCGGG + Intronic
1076293015 10:129362040-129362062 ACCTGGGGAGAGAAGGAGGCAGG + Intergenic
1077286413 11:1767938-1767960 ACCTGGGGAGAGGAGGCAGGAGG + Intergenic
1077350543 11:2091230-2091252 ATGTGGGTGGAGGTGGAAGAAGG + Intergenic
1077995788 11:7451521-7451543 ACATGGTTAGAGGGGGAAGAGGG - Intronic
1078898637 11:15621143-15621165 ACGTGGGTCCAGGTGGAGGCAGG - Intergenic
1079809294 11:24975714-24975736 AGCTGGGAAGGGGTGGAGGCAGG + Intronic
1083020049 11:59497475-59497497 GTCTGGGAAGAGGTTGAAGCAGG - Intergenic
1085218427 11:74852118-74852140 ACCTGGGTAGAGGTGAGGGGTGG - Intronic
1085273458 11:75283717-75283739 CCCTGGGGAGAGGTGGGAGGGGG - Intronic
1085393871 11:76196472-76196494 ACCTGGAGAGAGGTAGGAGCTGG - Exonic
1085459825 11:76686859-76686881 TCCTGAGTAGGGGTGGAAGCTGG - Intergenic
1086930233 11:92684518-92684540 CCCTTGGTAGAAGTGGAAGAAGG - Intronic
1088468507 11:110168206-110168228 ACTTCAGTAGAGGTGGCAGCTGG - Exonic
1088550371 11:111006529-111006551 AGATGGGTAGAGGCGGAAGTGGG - Intergenic
1089596369 11:119583544-119583566 ACCTGGGGAGAGGTGGGACCTGG + Intergenic
1089654185 11:119935134-119935156 CCCTGAGGATAGGTGGAAGCTGG - Intergenic
1089872169 11:121685327-121685349 ACCCAGGTGGAGGTGGAAGCAGG + Intergenic
1091347696 11:134866359-134866381 TCCTGGCGAGAGGGGGAAGCAGG - Intergenic
1092068518 12:5613187-5613209 AGCTGGGCAGAGGATGAAGCTGG + Intronic
1092238835 12:6825463-6825485 ACCTGGGGAAGGGTGGGAGCGGG - Exonic
1092861565 12:12724261-12724283 CCCAGGGTAGGGGTGGGAGCGGG - Intergenic
1093047756 12:14469281-14469303 ACCTGGGAAGAGGAGGTTGCAGG + Intronic
1096597912 12:52708979-52709001 AGGTGGGGAGAGGAGGAAGCGGG - Intergenic
1096829643 12:54304381-54304403 GGGTGGGTAGAGGTGGAACCAGG + Intronic
1097159613 12:57037090-57037112 AGCTGTGGAGAGGTGGAAGGGGG + Exonic
1097170766 12:57111375-57111397 ACCTGGGTAGAAGGAGAAGCCGG - Exonic
1097275442 12:57810314-57810336 ACCTGGTTTTAGCTGGAAGCTGG - Intronic
1097902027 12:64882833-64882855 ACATGGGCAGAGGTGGAGGAGGG - Intergenic
1099879572 12:88451530-88451552 ACCTAGGTATATGTGTAAGCAGG - Intergenic
1100528474 12:95442347-95442369 AGATGGGTATGGGTGGAAGCTGG - Intergenic
1101010615 12:100445470-100445492 TCATGGTTAGAAGTGGAAGCTGG + Intergenic
1101054912 12:100902637-100902659 ACATGAGTAGAGATGGAGGCTGG - Intronic
1101837313 12:108304512-108304534 AACAGGACAGAGGTGGAAGCAGG - Intronic
1102910880 12:116713055-116713077 ACCTGGCTGGAAGTGGGAGCCGG - Exonic
1104517466 12:129441313-129441335 ACCTGGGTAGATGTAGACCCAGG + Intronic
1104517585 12:129442314-129442336 ACCTGGGTAGATGTAGGACCAGG - Intronic
1104609073 12:130213658-130213680 ACCTGGGAGGATGTGGGAGCTGG - Intergenic
1106707656 13:32299158-32299180 AGATGGGCAGAGGTAGAAGCAGG + Intergenic
1108586293 13:51872967-51872989 ACAGGGGTAGAGGTGGCATCAGG + Intergenic
1113631059 13:111884153-111884175 CCCTGGGAACAGGTGGAATCTGG + Intergenic
1113992913 14:16042478-16042500 ACGTGGGTAGTGGGGGGAGCCGG - Intergenic
1114614392 14:24060572-24060594 ACCTGCGAAGATGTGGAAGCAGG + Intronic
1116956406 14:50928095-50928117 ACCTGGGTGCAGGTGGCAGCTGG + Intronic
1117736966 14:58777528-58777550 CCCTGGGCAGGGGTGGAAGCGGG - Intergenic
1118165498 14:63332105-63332127 ACATGGGTAGAGGAAGCAGCGGG + Intergenic
1118405669 14:65421350-65421372 AGCATGGTAGAGGTGGAAGGGGG + Intronic
1120379183 14:83751737-83751759 AGCTGGGTAGAGGGAGTAGCTGG + Intergenic
1121665711 14:95670636-95670658 GCTTGGGTGGAGGTGGGAGCTGG + Intergenic
1122101268 14:99412265-99412287 AGCTGGGAAGAGGTGGAGGCAGG - Intronic
1122146119 14:99689799-99689821 ACCAGGGTAGGGGAGGAAGCAGG - Intronic
1122214531 14:100194089-100194111 AGATGGGCAGAGGTGGAAGCAGG - Intergenic
1202895045 14_GL000194v1_random:2019-2041 TCCTGGGTAGAGGTGCCAGGAGG + Intergenic
1123719102 15:23047680-23047702 ACCTGGCCAGAGGTGGTAGGGGG + Intergenic
1123760126 15:23425417-23425439 ACATGGGTAGAGGGGCAGGCAGG - Intergenic
1124667814 15:31609058-31609080 ACAGGGGTAGAGGAGGCAGCGGG + Intronic
1126369751 15:47933317-47933339 ACCAGGTTAGAGCTGAAAGCGGG - Intergenic
1126763960 15:51995135-51995157 GCCAGGGCAGAGGAGGAAGCAGG + Intronic
1128009730 15:64281483-64281505 ACCTGGGAAGAGGGGAAAGTAGG + Intronic
1128860992 15:71071845-71071867 ACCTGGGTCCAGGAGGATGCTGG - Intergenic
1129534358 15:76299869-76299891 ACCAGGGTAAAGGGAGAAGCTGG - Intronic
1129679854 15:77652655-77652677 AGCTGGGCAGAGATGGGAGCAGG - Intronic
1129738500 15:77978628-77978650 ACCTGCGGGGAGGTGGCAGCAGG - Intergenic
1129847570 15:78774982-78775004 ACCTGTGGGGAGGTGGCAGCAGG + Intronic
1130145160 15:81268499-81268521 ACCTGGGCAGAGGAAGCAGCAGG - Intronic
1130220243 15:82013186-82013208 ACCTGGGTAGATGAGGTAGATGG + Intergenic
1130254331 15:82318927-82318949 ACCTGTGGGGAGGTGGCAGCAGG - Intergenic
1130568431 15:85019065-85019087 ACCTCTTTAGAGATGGAAGCAGG - Intronic
1130600634 15:85271043-85271065 ACCTGTGGGGAGGTGGCAGCAGG + Intergenic
1130936993 15:88479124-88479146 ACCTGGGTAGTGCTGGCAGTGGG + Exonic
1131261377 15:90889782-90889804 ACCTGGGTTGAGGGGGCAGGAGG + Intronic
1131565856 15:93484746-93484768 ACATGGGTGCAGGTGGAAGATGG - Intergenic
1131873018 15:96779975-96779997 ACCTGGATAGGGCTGGAAGGTGG + Intergenic
1132044419 15:98551297-98551319 AGCTAGCTAGAGGTGGAGGCTGG - Intergenic
1132294136 15:100722973-100722995 CCCTGGGTAGAGGGAGAAGAGGG - Intergenic
1133400942 16:5486480-5486502 GCTTGGGTAGATGGGGAAGCCGG + Intergenic
1133819897 16:9226764-9226786 ACCCAGGTGGAGGAGGAAGCAGG - Intergenic
1134340956 16:13345394-13345416 ACATGGATGGAGCTGGAAGCCGG - Intergenic
1134456213 16:14397459-14397481 ACATGGGTAGAGGGGCAGGCAGG + Intergenic
1135159716 16:20083004-20083026 ACTTGGGAGGAGGTGGAGGCAGG - Intergenic
1135392402 16:22104905-22104927 ATCTGGGTAGAGGTGGGGACTGG - Intronic
1135607051 16:23834448-23834470 ACCTGAGTAGTGGTGGATGAAGG - Intergenic
1136249666 16:28996026-28996048 CCCTGGGTGGAGGCGGAGGCAGG + Intergenic
1136610592 16:31362856-31362878 ACCTGGGGAGAGGTGGGACCTGG + Intronic
1136912282 16:34154230-34154252 ACGTGGGTAGTGGGGGGAGCCGG - Intergenic
1137054808 16:35739533-35739555 AACTGGGGAGAGGTGGAGGGTGG + Intergenic
1137575671 16:49598504-49598526 ACCTGTGTAGAGGAGAAAGGGGG + Intronic
1138328418 16:56193296-56193318 TCCAAGGTAGAGGTGGAAGGGGG + Intronic
1139530328 16:67539499-67539521 CCCAGGGAAGAGGTGGAAGGAGG + Intronic
1144188061 17:12814988-12815010 CCCTGGGTAGGGGTGGGAGAAGG - Intronic
1144301020 17:13923133-13923155 GCCTGGGATGAGCTGGAAGCAGG + Intergenic
1144383625 17:14728107-14728129 AACTGGGTAGGGGTGGAGGTGGG - Intergenic
1144802366 17:17938603-17938625 ATGTGGGTAGAAGTGGAATCTGG - Intronic
1145773700 17:27511577-27511599 ACCTGGGGCGAGGTGGGAGTGGG + Intronic
1147760094 17:42792320-42792342 CCCTGGGGATAGGGGGAAGCTGG - Intronic
1148238877 17:45986808-45986830 ACCTGGCAAGAGGGGGCAGCAGG - Intronic
1149656159 17:58310591-58310613 CCCTGGGTGGAGCTGGAGGCCGG + Exonic
1150439811 17:65182027-65182049 CCCTGGTTAGAGGTGGAAGGAGG + Intronic
1151564778 17:74892028-74892050 AACTGGGAAGGGGTGGAAGAAGG + Intronic
1151681942 17:75626984-75627006 ACCTGGGCAAGGCTGGAAGCTGG + Exonic
1151803305 17:76390446-76390468 ACCTGGGTGGTGGTGGCAGCAGG + Exonic
1152602358 17:81270849-81270871 GGCTGGGGAGAGGTGGAGGCGGG - Intronic
1152683365 17:81681658-81681680 AGCTGGGGAGAGGTGGCAGAGGG - Exonic
1152844024 17:82588363-82588385 AGCTGGGAGGAGATGGAAGCCGG + Intronic
1152947044 17:83203596-83203618 CCCAGGGTAGAGGTGCAAGAGGG - Intergenic
1152951138 17:83232547-83232569 ACCTGGGGAGACGTGGCTGCAGG + Intergenic
1153744420 18:8162585-8162607 ACCTGTGTTGAGGAGGTAGCGGG - Intronic
1155332197 18:24729775-24729797 ACCTGGGTATAATTGGAAGGTGG - Intergenic
1155928278 18:31680544-31680566 CTCTGGGTAGAGGTGAAATCTGG - Intronic
1156538630 18:37888113-37888135 ACCTGGGCAGCGGTGGGAGATGG + Intergenic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1157602254 18:48901518-48901540 ACCTGGGTAGAGGCTGAGGTAGG - Intergenic
1158616284 18:58990790-58990812 GCCTGAGTAGGGGTGGAAGCTGG + Intergenic
1158643825 18:59225771-59225793 ATCTGGGGAGAGGTGGAAAGAGG + Intronic
1160284752 18:77531093-77531115 CCCTGGTCTGAGGTGGAAGCTGG - Intergenic
1160438753 18:78872355-78872377 ACCTGAGTGGAGGGGGAAGATGG + Intergenic
1160614644 18:80115730-80115752 AACTGGGAAGTGATGGAAGCAGG - Intronic
1161443520 19:4305273-4305295 ACCTGGGCAAAGGTGGAACCTGG - Intronic
1163196241 19:15723171-15723193 ACGTGGGGAGAGGTGGCAGGCGG + Intergenic
1163537552 19:17885736-17885758 AGCTGGGGAGAGGGGGAAGTGGG - Intronic
1163562752 19:18030150-18030172 CCCTGGCTAGAGGTGGCCGCAGG - Intergenic
1163883038 19:19944303-19944325 ACCTGGGAAGAGGTAGACTCTGG + Intergenic
1163902891 19:20122096-20122118 ACCTGCGTGGAGGCTGAAGCAGG + Intronic
1164620733 19:29694726-29694748 ACCTGGGGAGAGGAGGAGGAAGG + Intergenic
1164723555 19:30450452-30450474 CCCTGCCTAGAGGTGGAAGGTGG - Intronic
1166006892 19:39914256-39914278 ACCTGGGTGGAGATGCAAGAGGG + Exonic
1166718802 19:44985915-44985937 ACCGAGGTAGAGGTAGAGGCAGG - Intronic
1166852407 19:45766991-45767013 ACCAGGATGGAGGAGGAAGCCGG + Exonic
1167117931 19:47498894-47498916 ACCTGGGTAGAGCTGAGAGCAGG - Intronic
1167281607 19:48572546-48572568 ACCTGTGTCGAGGTGGAAGGAGG + Intronic
1168292654 19:55364161-55364183 AGCTAGGGAGAGGTGGAAGTGGG - Intergenic
925824831 2:7837492-7837514 GCCTGGGGAGAGTGGGAAGCTGG - Intergenic
926222046 2:10942700-10942722 CCCTGGGCAGAGGTGGCTGCTGG + Intergenic
928329442 2:30346604-30346626 GCCTGGATGGAGGGGGAAGCAGG - Intergenic
928733645 2:34261204-34261226 ACAGGGGTAGAGGTAGCAGCAGG + Intergenic
928899393 2:36301193-36301215 ATCATGGTGGAGGTGGAAGCAGG + Intergenic
929262463 2:39881018-39881040 AACTGGGGGGAGGAGGAAGCAGG + Intergenic
929431572 2:41892090-41892112 TCCTGGGTAGATGTGAAAGTAGG + Intergenic
929966952 2:46543168-46543190 ACCTGCGTAGTGGTCGAAGACGG - Exonic
930486600 2:52018318-52018340 ACCTGGGTAGAGGAAGCAGTGGG - Intergenic
931016597 2:57988704-57988726 GTCTGGGAAGAGGTGGAAGTAGG - Intronic
931218551 2:60268170-60268192 AGCTGGTGAGAGGTGGAGGCAGG - Intergenic
931751017 2:65329972-65329994 ACAGGGGCAAAGGTGGAAGCAGG - Intronic
932590036 2:73059651-73059673 ACCTGGGTAGGGGTGGCATTAGG - Intronic
934157048 2:89212913-89212935 ATCTGGGTAGTGTTGGAAGAAGG + Intergenic
934210268 2:89969833-89969855 ATCTGGGTAGTGTTGGAAGAAGG - Intergenic
936469644 2:112787456-112787478 ACATGGTTAGTGGTGGAATCCGG + Intergenic
938493148 2:131776381-131776403 TCCTGGGTAGAGGTGCCAGGAGG - Intergenic
938499332 2:131822272-131822294 TCCTGGGTAGAGGTGCCAGGAGG + Intergenic
938802850 2:134778610-134778632 ACCTGGGTATAGGTGGCAGGTGG - Intergenic
939098807 2:137870220-137870242 AACTAGGTAGAGGGGGAAGGTGG - Intergenic
940563288 2:155329281-155329303 ACCTGAGTCGAGGAGGAAGGAGG + Intergenic
942994801 2:182248438-182248460 ACCTGGGTGCAGATGGCAGCCGG + Intronic
944295670 2:198059656-198059678 TCCTGGGTAGAGGAGGCAGGGGG - Intronic
947199164 2:227599264-227599286 TCCTGGGCAGGGGTGGAACCAGG - Intergenic
947700570 2:232230848-232230870 AGCAGGGAAGAAGTGGAAGCAGG - Intronic
1168872355 20:1141155-1141177 GCCAGGGTGGAGGTGGAAGATGG + Intronic
1169145298 20:3248508-3248530 CACTGGGCAGATGTGGAAGCTGG - Intergenic
1170109111 20:12785636-12785658 ACTTGGACAGAAGTGGAAGCAGG + Intergenic
1170653643 20:18265918-18265940 TCCTGGGGATAGGTGGAAGAAGG - Intergenic
1170653814 20:18267642-18267664 CCCTGGGGATAGGTGGAAGAAGG + Intergenic
1171032726 20:21691734-21691756 CTCTGGGAAGAGGTGGCAGCTGG + Intergenic
1172094903 20:32455852-32455874 GCCTTGGTAGAGGTGGTAGGTGG - Intronic
1172195329 20:33087800-33087822 ATCTGAGGAGAGGTGGAACCAGG + Intronic
1172475784 20:35236521-35236543 ATATGGGTAGAGGAGGAAGCAGG + Intronic
1173152680 20:40581352-40581374 ACCTGTGTAGAGGTGGTAGGCGG - Intergenic
1173722635 20:45272871-45272893 ACCTGCTTGGAGGTGGGAGCTGG - Intergenic
1174620684 20:51872281-51872303 TCCTGGGCAGAGATGGCAGCAGG - Intergenic
1175851947 20:62098323-62098345 ACCTGGGAGGAGGTGCAGGCCGG - Intergenic
1175937933 20:62523491-62523513 ACCTGGGCAGATGTGGACTCAGG + Intergenic
1176002551 20:62839566-62839588 ACCCAGGCAGAGGTGGGAGCGGG - Intronic
1176177832 20:63737075-63737097 AACTGGGAAGAGCTGGAGGCTGG - Intronic
1176424111 21:6537240-6537262 ACCAGGGGAGCTGTGGAAGCAGG + Intergenic
1176552752 21:8236149-8236171 ACGTGGGTAGTGGGGGGAGCCGG - Intergenic
1176571650 21:8418552-8418574 ACGTGGGTAGTGGGGGGAGCCGG - Intergenic
1176579562 21:8463115-8463137 ACGTGGGTAGTGGGGGGAGCCGG - Intergenic
1176614747 21:9018006-9018028 TCCTGGGTAGAGGTGCCAGGAGG + Intergenic
1177651838 21:23968198-23968220 ACCTGGGTTGCGGGGGAACCAGG - Intergenic
1179109944 21:38437755-38437777 TCCTGGGTATAGTTGGAAGGTGG - Intronic
1179699604 21:43145555-43145577 ACCAGGGGAGCTGTGGAAGCAGG + Intergenic
1180314357 22:11265041-11265063 ACGTGGGTAGTGGGGGGAGCCGG + Intergenic
1180341001 22:11618510-11618532 ACGTGGGTAGTGGGGGGAGCCGG - Intergenic
1180972306 22:19821988-19822010 CCATGGGCAGAGGTGGCAGCAGG - Intronic
1182718135 22:32376471-32376493 ACCTGGGAAGAAGTGGGTGCTGG - Intronic
1183601309 22:38842216-38842238 ACCTGGGTGGAGGTAGCAGAGGG + Intronic
1183718967 22:39551137-39551159 ACTGGGGAAGAGGTGGAAGAGGG - Intergenic
1183782646 22:40008622-40008644 ACCTGAGTGGGGGTGGAAGACGG + Intronic
1183830993 22:40418349-40418371 ACCTGGGTATGGGAGGAACCGGG - Intronic
1184859798 22:47166833-47166855 GCCGGGGTACAGGTGGGAGCTGG + Intronic
1185134604 22:49062566-49062588 ACCTGGGGCCAGGTGGAAGGCGG - Intergenic
1185134623 22:49062642-49062664 ACCTGGGGCCAGGTGGAAGGGGG - Intergenic
1185183597 22:49378829-49378851 ACCTGGGGGTAGGTGCAAGCGGG - Intergenic
1203257731 22_KI270733v1_random:152551-152573 ACGTGGGTAGTGGGGGGAGCCGG - Intergenic
949098806 3:118688-118710 AATTTGGTAAAGGTGGAAGCAGG + Intergenic
950211593 3:11127246-11127268 ACCAGGGCAGATGTGGAGGCAGG + Intergenic
950283043 3:11723180-11723202 ACCTGGGTGGGGGTGGGGGCAGG + Intergenic
950424188 3:12915732-12915754 ACCTGGGTAGGGGATGCAGCTGG + Exonic
950481721 3:13248231-13248253 ACGTGGGTTCAGGAGGAAGCCGG + Intergenic
950566462 3:13772470-13772492 CCCTGGGTAGTGGTGGAAGCTGG + Intergenic
950721202 3:14883903-14883925 GCCAGGGTAGTGGTGGAAGAGGG + Intronic
952866032 3:37855694-37855716 ACAAGGGTAGAGGTAGAAGATGG + Intergenic
952998121 3:38904951-38904973 ACCTGGGTAGAGGTGGAAGCTGG - Intronic
953007856 3:38994780-38994802 ACCTGGAGACAGATGGAAGCTGG + Intergenic
953921258 3:46953560-46953582 ACCTGGCTAAATGGGGAAGCAGG + Intronic
953926754 3:46986439-46986461 AGAGGGGGAGAGGTGGAAGCTGG + Intronic
954623198 3:52007286-52007308 ACCTGGGTGGGGGTGGGAGGGGG - Intergenic
955193038 3:56779615-56779637 AGCTGGGAAGAGGCAGAAGCAGG - Intronic
956725167 3:72151029-72151051 ACCTGAGCAAAGGTGGAAGTTGG - Intergenic
957980246 3:87500180-87500202 GTGTGGGTGGAGGTGGAAGCTGG - Intergenic
958013712 3:87914164-87914186 ACAGGGGTAGAGGTGGCAGCAGG + Intergenic
958498270 3:94873963-94873985 CCCTTGGTAGATGTGGAATCCGG - Intergenic
959117776 3:102197793-102197815 ACCTGGAACCAGGTGGAAGCTGG - Intronic
961717905 3:128871263-128871285 GAATGGGTAGAGGTGGAATCTGG + Intergenic
962007554 3:131362951-131362973 AACTTGGGAGTGGTGGAAGCTGG - Intergenic
962251825 3:133840447-133840469 ACCTGAGTGCAGGTGGGAGCTGG - Intronic
962722275 3:138187298-138187320 CCTGGGTTAGAGGTGGAAGCGGG - Exonic
963018080 3:140844797-140844819 ACCATGGTAGAAGGGGAAGCAGG + Intergenic
964089463 3:152857385-152857407 AGCTGGGGAGAGGTTGATGCTGG - Intergenic
964518975 3:157543219-157543241 ACCTGGGAAGGGGCGGTAGCGGG + Intergenic
964640373 3:158903761-158903783 ACTGGGGTAGAGGGGCAAGCAGG - Intergenic
964808271 3:160635374-160635396 ACCTTGGAAGAATTGGAAGCAGG + Intergenic
966511688 3:180771345-180771367 AACTTTGTGGAGGTGGAAGCTGG + Intronic
966578074 3:181525924-181525946 AAGTGGGTTGGGGTGGAAGCAGG - Intergenic
967629605 3:191730056-191730078 GCCTGTGTAGAGGTGGAGGGAGG - Intergenic
968374035 4:23001-23023 ACCTGGGCAGACGTGGCTGCTGG - Intergenic
968520477 4:1032711-1032733 TCCGGGGTAGCGGTGGAGGCGGG + Intergenic
969206618 4:5652034-5652056 ACCAGGGAACAGGGGGAAGCTGG + Intronic
969377388 4:6771835-6771857 ACCTGGGTACATCTGGAGGCTGG + Intergenic
969691261 4:8705407-8705429 GCCTGGGGAGAGAGGGAAGCTGG + Intergenic
969838749 4:9864960-9864982 AGCTCAGAAGAGGTGGAAGCAGG - Intronic
970016734 4:11520465-11520487 ACCTTGCTAGAGAGGGAAGCAGG - Intergenic
973204968 4:47550110-47550132 CCTTGGGTAGAGGTGGAACTAGG + Intronic
977566386 4:98584944-98584966 ACTTGGGAAGCGGTGGAAGGAGG - Intronic
979690610 4:123554852-123554874 ACCTGGGAAGAGGAGGGGGCAGG - Intergenic
980053953 4:128062069-128062091 GCCCGGGAAGAGGTGGCAGCTGG + Intronic
982175833 4:152704696-152704718 AGCTGGGGCAAGGTGGAAGCAGG - Intronic
983087994 4:163470960-163470982 ACCTGGAAAAAGGTTGAAGCTGG - Intergenic
985460695 4:190103267-190103289 ACCTGGGCAGACGTGGCTGCTGG + Intergenic
986244915 5:5998443-5998465 AGCTGTGTAGAGCTGGAGGCAGG - Intergenic
986746699 5:10751093-10751115 CCCTGGGGAAAGGTGGAAGAGGG - Intronic
986904845 5:12484277-12484299 ATCTGGGGAGAGGGGGAAACAGG + Intergenic
986914561 5:12602601-12602623 ACATGGTGAGAGGTGGTAGCAGG - Intergenic
990539394 5:56757210-56757232 GCCTGGGCAGAGGTGCCAGCCGG - Intergenic
990992257 5:61697821-61697843 AGCAGGGAAGAAGTGGAAGCAGG - Intronic
991176133 5:63689428-63689450 TCCTGGGCAGAGGTGCATGCAGG - Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998655199 5:144170796-144170818 GCCTGGTTAGGGGTGGAACCAGG + Intergenic
999770308 5:154770518-154770540 CCCAGGGTAGAGGTGGAATGAGG + Intronic
1000962221 5:167613463-167613485 ACCTGGTAAGAGGTAGAGGCTGG + Intronic
1002600962 5:180353607-180353629 ACCAGAGTAGGCGTGGAAGCCGG + Intergenic
1002745368 5:181466361-181466383 ACCTGGGGAGACGTGGCTGCAGG + Intergenic
1003740901 6:8937859-8937881 ACTTGGGTGGTGGTGGAGGCAGG - Intergenic
1004189725 6:13453218-13453240 ACCTGGATCGACCTGGAAGCAGG - Intronic
1004195726 6:13502936-13502958 ACCCTGGTAGAGGTGGAGGTTGG + Intergenic
1004609125 6:17222431-17222453 ACCAGGGTGGAGGGGGAAGCAGG - Intergenic
1005056027 6:21729473-21729495 TCCTTGTTAGAGGTGGATGCTGG + Intergenic
1005319131 6:24634885-24634907 ACCTGGCTAGAGGGGAAAGAGGG + Intronic
1005994621 6:30923706-30923728 ACCTGGGGAGAGGAGGAGGAGGG + Intronic
1006561553 6:34917268-34917290 ACCAGTGGAGAGGTGGCAGCAGG + Intronic
1006604283 6:35244931-35244953 AGTTGGGGAGAGGTGGAAGGTGG - Intronic
1007777739 6:44233188-44233210 ACTTGGGTGGAGGTGGAGACAGG + Intronic
1012718960 6:102716557-102716579 ACCTGGGGATAGGAGGGAGCTGG + Intergenic
1012846500 6:104396103-104396125 ACCTGGGTAGAGTTGAAAGAGGG - Intergenic
1015823788 6:137291047-137291069 GCCCAGGTAGAGGTGGAGGCTGG + Intergenic
1017127809 6:151081918-151081940 AGATGGGAAGAGGAGGAAGCAGG - Intronic
1018402793 6:163442497-163442519 ACCAAGGTAGTGGTGGAAGCAGG + Intronic
1019250284 6:170739907-170739929 ACCTGGGGAGACGTGGCTGCAGG + Intergenic
1022908044 7:34875028-34875050 AACTGGTCAGTGGTGGAAGCAGG - Intronic
1023621468 7:42077596-42077618 GACTGGGGAAAGGTGGAAGCAGG - Intronic
1025710206 7:63901175-63901197 CCCTGGGTACAGGTGGGAGAGGG - Intergenic
1026443254 7:70461807-70461829 ACCTGGGGACAGGTGGAGGTGGG + Intronic
1028105023 7:86867185-86867207 TCGTGGGTAGAGGGAGAAGCAGG - Intergenic
1029440196 7:100583105-100583127 ACCTGGTTGGAGATGGGAGCTGG + Intronic
1032248919 7:130236238-130236260 AACTGGGAAGATGTGGAAGAAGG + Intergenic
1033333351 7:140433070-140433092 ACCTGGGAAGAGGTGGAAAGGGG + Intergenic
1033720296 7:144051567-144051589 TCCTGGGTAGGGGTGGGACCTGG - Intergenic
1034748179 7:153542737-153542759 ACCTGGGGAGAAGGGGAAACAGG + Intergenic
1035492402 7:159291724-159291746 ACCTGGGGAGGGGTGGAGACAGG - Intergenic
1035497095 8:61778-61800 ACCTGGGGAGACGTGGCTGCAGG - Intergenic
1035514275 8:219302-219324 ACCTGGGGAGACGTGGCTGCAGG - Intergenic
1036601082 8:10260630-10260652 ACCTGGGCAGAGGTAGACACAGG + Intronic
1036808513 8:11851619-11851641 TCCTGGGCAGAGGTTGAGGCAGG - Intronic
1037299215 8:17433879-17433901 GCCTGGGGGGAGGTGGAACCAGG - Intergenic
1038296494 8:26296094-26296116 ACCTGAATAGAGGTGAAAGCAGG - Intronic
1038736180 8:30171672-30171694 ACCTGAGTAGAGGTGCAAAGTGG + Intronic
1039728683 8:40251493-40251515 ACCTGGGCAGAGGAAGAAGTAGG - Intergenic
1041150192 8:54924449-54924471 ATCTGGCTAGAGGGGGAAGTGGG + Intergenic
1043597036 8:81899036-81899058 AGCTGGGGAGAGGTAGAAGGTGG + Intergenic
1044256845 8:90073509-90073531 ATCTGGGCAGAGGGAGAAGCTGG - Intronic
1044326586 8:90865614-90865636 ACCAGGGTAGAAGTGGAGACTGG - Intronic
1044625576 8:94232871-94232893 ACCCGGGAAGTGGTGGAACCAGG + Intergenic
1046148227 8:110189624-110189646 CCCTGGGTAGGAGTGGATGCTGG + Intergenic
1046996561 8:120530475-120530497 AGCTGGGCAGAGGTGGGAGATGG - Intronic
1047509856 8:125507729-125507751 ACCTGGCTTGAGTTGGCAGCAGG - Intergenic
1047882793 8:129215079-129215101 ACTTGGGTAGGGGTGAAAGGAGG + Intergenic
1048983361 8:139715288-139715310 AGCCGGGTAGAGGTGGTAGCAGG + Intergenic
1051357632 9:16254374-16254396 ACCTGGGGAGAAAGGGAAGCTGG - Intronic
1051371164 9:16360394-16360416 ACATGGGTAGAGGTGGGATTGGG - Intergenic
1051565262 9:18490175-18490197 GCCTGGCCAGAGCTGGAAGCAGG + Intronic
1051910952 9:22154190-22154212 CCCAGGGTACAGGAGGAAGCTGG + Intergenic
1056431930 9:86536238-86536260 ACCTGGCTAGGAGTGGAAGATGG - Intergenic
1056478949 9:86981512-86981534 AACTGGGTAAAAGTGGAAACAGG - Intergenic
1056808464 9:89746169-89746191 ACCTGGGGAGGGCTGGCAGCTGG - Intergenic
1056958169 9:91099250-91099272 AGCTTGGTAGAGGAGGAAACAGG - Intergenic
1057716869 9:97502206-97502228 AGCTGGGTACAGGTGCCAGCCGG + Intronic
1058093682 9:100834898-100834920 AGGTGGGTAGAGGTGGAGACTGG + Intergenic
1059027445 9:110650288-110650310 AACTGGGTAGATGTGAAGGCAGG - Intergenic
1059067318 9:111099164-111099186 ACCTGGGTGGGGGTGGAACTGGG - Intergenic
1059391849 9:114004285-114004307 AGCTGGGAGGAGGTGGGAGCTGG + Intronic
1059915799 9:119098727-119098749 ACCTGAGTAAAGCTGGAGGCTGG + Intergenic
1060420756 9:123468035-123468057 ACCTGGGTACAGGTGGTGGTTGG - Intronic
1061339389 9:129966985-129967007 ACTGGGGTAGATGTGGAAGAGGG + Intronic
1061951605 9:133939418-133939440 GCCTGGATGGAAGTGGAAGCAGG + Intronic
1062623227 9:137431786-137431808 ACCTGGGGAGAGGCGGAGGAAGG + Intronic
1062637239 9:137498129-137498151 GACTGGGTGGAGGTGGAGGCCGG - Exonic
1203473923 Un_GL000220v1:134573-134595 ACGTGGGTAGTGGGGGGAGCCGG - Intergenic
1203362663 Un_KI270442v1:231162-231184 ACGTGGGTAGTGGGGGGAGCCGG + Intergenic
1187174444 X:16883391-16883413 CCGTGGCTAGAGGTGGAAACTGG - Intergenic
1187250476 X:17593660-17593682 ACCTGGATGGAGGTGGAAACAGG - Intronic
1187391825 X:18891123-18891145 ACCTGCGTGGAGGTGGCAGGAGG - Intergenic
1187675319 X:21710735-21710757 AACTGTGAAGAGGGGGAAGCTGG + Intronic
1187941011 X:24381143-24381165 AGCTAGGGAGAGGTGGAACCAGG + Intergenic
1189213552 X:39304397-39304419 GCCAGGCCAGAGGTGGAAGCAGG + Intergenic
1189408049 X:40743605-40743627 ATCTGGGTAGAGGTGGTGGATGG - Intergenic
1191756643 X:64600016-64600038 AGGTGGATAGAGGTGGAAGAGGG - Intergenic
1192137387 X:68616548-68616570 CCCTCAGTAGAGGTGGATGCTGG - Intergenic
1195364217 X:104112163-104112185 ACCTTTGTATAGGGGGAAGCGGG - Intronic
1195626075 X:107006673-107006695 AACTGGGCAGAGGAGGAAGTGGG + Intergenic
1197910591 X:131479264-131479286 ACAGGGGTAGAGGAAGAAGCAGG + Intergenic
1199219169 X:145297201-145297223 ACTGGGGTAGGGGTGGAATCGGG + Intergenic
1200134102 X:153866586-153866608 ACATGGGCTGGGGTGGAAGCAGG + Intronic
1200252588 X:154561606-154561628 AAGGGGGTAGAGTTGGAAGCAGG + Intronic
1200265179 X:154642810-154642832 AAGGGGGTAGAGTTGGAAGCAGG - Intergenic
1201934756 Y:19396449-19396471 ACCTGGGTAGAGGAGGCAGTGGG - Intergenic